Labshake search
Citations for Lonza :
1 - 50 of 1351 citations for 8 4 ethoxy 3 methoxyphenyl 1 5 diazabicyclo 3.2.1 octane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... Between 1×10^3 – 5×10^4 cells were re-suspended in 20μl Buffer P3 (Lonza) per reaction and quickly added to the Eppendorf tube containing the CRISPR/Cas9 gRNA RNP complex ...
-
Synthetic lethal targeting of TET2-mutant hematopoietic stem and progenitor cells by XPO1 inhibitorsbioRxiv - Cancer Biology 2022Quote: ... or either of two different gRNAs targeting exon 3 coding sequences of human TET2 (TET2-gRNA #1: 5’-TGGAGAAAGACGTAACTTC-3’ and TET2-gRNA #2: 5’-TCTGCCCTGAGGTATGCGAT-3’) were transfected with Nucleofector (Lonza). After transduction ...
-
bioRxiv - Microbiology 2022Quote: ... EMEM (ATCC; MRC-5 and Calu-3 cells) (Lonza; Tb-1 Lu cells) or MEM (Gibco ...
-
bioRxiv - Genetics 2019Quote: ... Between 1×10^4 – 5×10^4 cells per condition were resuspended in 20μl of Buffer P3 (Lonza) per reaction and quickly added to the Eppendorf tube containing the Cas9 gRNA RNP complex ...
-
bioRxiv - Cell Biology 2020Quote: ... and 8 × 105 cells were electroporated using 5 mg of total DNA (Ratio 1:1) and the Amaxa Nucleofector kit (Lonza) as described (Ran et al. ...
-
bioRxiv - Biophysics 2021Quote: ... in passages 4-8 were cultured in EGM2-MV medium (Lonza) at 37°C in a humidified atmosphere of 95% air and 5% CO2 ...
-
bioRxiv - Cell Biology 2022Quote: ... in passages 4-8 were cultured in EGM2-MV medium (Lonza) at 37°C in a humidified atmosphere of 95% air and 5% CO2 ...
-
bioRxiv - Cell Biology 2024Quote: ... in passages 4-8 were cultured in EGM2-MV medium (Lonza).
-
bioRxiv - Genetics 2020Quote: ... ∼1×106 cells were transfected with pairs of 5 µg gRNA plasmid and 4 µg ssODN (Supplementary Table 3) using AmaxaTM Human CD34 Cell NucleofectorTM Kit (Lonza) in the 2B-NucleofectorTM on the U-08 setting ...
-
bioRxiv - Bioengineering 2023Quote: ... in passages 5-8 were cultured at 37°C and 5% CO2 in EGM2 cell medium (Lonza). Cells were detached from the adhering surface using TrypLE (Life Technologies ...
-
bioRxiv - Biophysics 2021Quote: ... The WT and mutant genes were then amplified from these expression plasmids using the PCR primers 5’-GCGCTAGCAGCACCCATATGCCTGAG-3’and 5’-ACGAAGCTTTCAGTGGTGGTGGTGGT-3’and subcloned into the pMaxCloning vector (Lonza, VDC-1040) via NheI and BamHI sites to generate the pMax_WT_NEIL1 and pMax_Mutant_NEIL1 expression plasmids that were utilized throughout this analysis.
-
bioRxiv - Developmental Biology 2020Quote: ... about 8 × 105 iPSCs were transfected with 5 μg of plasmids with Lonza Human Stem Cell Nucleofector Kit 1 (Lonza, VPH-5012) on a Nucleofector 2b device (Lonza ...
-
bioRxiv - Neuroscience 2021Quote: ... Tissues were washed 3-4 times over 1 hour in PBS (calcium- and magnesium-free; Lonza BioWhittaker #17-517Q) containing 0.1% Triton X-100 (PBT ...
-
bioRxiv - Bioengineering 2023Quote: ... Adipose-derived stem cells (Passage 3-5) (Lonza, Walkersville, MD, USA) were cultured in a basal medium consisting of DMEM/F12 ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were passaged 1:10 every 3-4 days by trypsinisation and were regularly screened for mycoplasma contamination (Mycoalert, Lonza).
-
bioRxiv - Cell Biology 2022Quote: ... followed by 3-4 days of culture in SmGM complete media (Lonza) supplemented with 1% penicillin-streptomycin to expand cell numbers ...
-
bioRxiv - Cancer Biology 2023Quote: ... Every 3-4 weeks the medium was additionally supplemented with MycoZap (Lonza) to prevent mycoplasma contamination ...
-
bioRxiv - Neuroscience 2023Quote: ... split into 3-4 wells each and cultured in DMEM-F12 (Lonza) containing 10% fetal bovine serum (FBS ...
-
bioRxiv - Bioengineering 2021Quote: ... were used between passages 3-5 for paxillin experiments and culture medium was changed every 2-3 days (Lonza FBM Basal Medium supplemented with 2 v/v% fetal bovine serum (FBS) ...
-
bioRxiv - Cell Biology 2023Quote: Drosophila ovaries (5-8 pairs per sample) were dissected into room temperature Grace’s insect medium (Lonza). Ovaries were fixed for 10 min using 4% paraformaldehyde diluted in Grace’s medium ...
-
bioRxiv - Bioengineering 2020Quote: ... passage 3-5 AFC were dissociated and resuspended in EGM-2 (Lonza) at 4×105 cells/mL ...
-
bioRxiv - Neuroscience 2023Quote: ... iPS cells were passaged every 3-4 days with Accutase (Lonza, Basel, Switzerland) and seeded on new plates with density 1:5 – 1:10 in iPS medium with ROCK inhibitor Y-27632 (Sigma-Aldrich) ...
-
bioRxiv - Bioengineering 2023Quote: ... using antibiotic-free endothelial media and were lifted for seeding at passage 5-8 (Lonza, Walkersville, MD). After lifting ...
-
bioRxiv - Genomics 2019Quote: ... The products were size selected on a 3% NuSieve 3:1 Agarose gel (Lonza), purified using NucleoSpin Gel and PCR clean-up columns ...
-
bioRxiv - Microbiology 2022Quote: ... pH 8 (Lonza), stained with SyberGreen (Sigma Aldrich) ...
-
bioRxiv - Systems Biology 2023Quote: ... 5% CO2 in 1:1 RPMI:MEGM (Lonza, #CC-3151), 3% fetal bovine serum (FBS,Gibco) ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... supplemented with Ultraglutamine-1 (4 mM; Lonza) and antibiotic-antimycotic (1% ...
-
bioRxiv - Neuroscience 2019Quote: ... After 3 to 4 passages cell were electroporated via Nucleofection with the AMAXA nucleofection device (LONZA). The Neurospheres were dissociated with Accutase (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... and 5 U ml−1 Penstrep (Lonza). Hb9-GFP mouse stem cells were cultured as described (Wichterle et al ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 U ml−1 Penicillin-streptomycin (Lonza) and 5 mM sodium pyruvate ...
-
bioRxiv - Biophysics 2021Quote: Commercially available primary human umbilical vein endothelial cells (HUVECs) (pooled, passages 3-5, Lonza, Basel, Switzerland) were grown in EGM-2 medium (Lonza ...
-
bioRxiv - Developmental Biology 2024Quote: ... Undigested and digested products were resolved in a 3% Metaphor 1:1 (Lonza)/agarose gel (Invitrogen ...
-
bioRxiv - Genomics 2019Quote: ... The DNA fragments of 150–200 bp length were gel-extracted on 3% NuSieve 3:1 Agarose (Lonza). Both samples were sequenced by GATC Biotech AG (Konstanz ...
-
bioRxiv - Cell Biology 2022Quote: ... Electroporation with the CA-137 program was performed 3-5 min after this addition (Lonza Group AG). Following this ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 5 U ml−1 Penicillin-streptomycin (Lonza). Neuro-2a (N2A ...
-
bioRxiv - Molecular Biology 2021Quote: Inguinal white adipose tissue from 3-4 WT-C57Bl/6 male mice was collected and placed in Dulbecco’s modified eagle’s medium (DMEM; Lonza) supplemented with 1% Penicillin/Streptomycin (PS ...
-
bioRxiv - Cancer Biology 2023Quote: ... Regular testing for mycoplasma contamination was conducted every 3-4 weeks using the MycoAlert PLUS mycoplasma detection kit (Lonza).
-
bioRxiv - Neuroscience 2023Quote: Larvae were anesthetized with 0.02% ethyl 3-aminobenzoate methanesulfonate salt (Tricane, (E10521, Ethyl 3-aminobenzoate methanesulfonate) and mounted in 1% low melting point agarose (50100, Lonza) in a 60 mm x 15 mm petri dish ...
-
bioRxiv - Immunology 2022Quote: ... 1 × 106 cells were transfected with 8 μg ScaI-linearized plasmid using the Amaxa Nucleofector (Lonza) SF kit on program DS-113 ...
-
bioRxiv - Cell Biology 2021Quote: ... Passaging of iPSCs was carried out every 4-5 days using Versene (EDTA 0.02%) (Lonza, BE17–771E) solution for 3–5⍰minutes at 37⍰°C ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5 × 106 cells were co-transfected with 5 μg of pSpCas9(BB)– 2A–Puro:sgRNA #4 plasmid and 5 μg of pCSII–CMV:A3B–3×FLAG–IRES–EGFP donor DNA plasmid using the Amaxa Nucleofector (Lonza) with nucleofection solution R ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA directed against Dsg1 (Integrated DNA Technologies) with a targeting sequence 5′-CCATTAGAGAGTGGCAATAGGATGA-3′ using Amaxa Nucleofector System (Lonza) for electroporation of cells according to manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2020Quote: ... at Day 3-4 of phase I culture were electroporated using P3 Primary Cell 4D NucleofectorTM X Kit (from Lonza) with program DZ100 (Bak et al. ...
-
bioRxiv - Immunology 2021Quote: ... 2.106 T cells were resuspended in 20 µl of nucleofection solution with 3 µl or 4 µl RNP and transferred to Nucleofection cuvette strips (4D-Nucleofector X kit S; Lonza). Murine T cells were electroporated using the DN110 program of 4D nucleofector (4D-Nucleofector Core Unit ...
-
bioRxiv - Cell Biology 2021Quote: ... were isolated from healthy donors (n=3) as described[4] and seeded on 6 cm dishes within BEGM media (Lonza) before transduction with lentivirus (empty vector (Origene ...
-
bioRxiv - Developmental Biology 2021Quote: ... The resulting mixture was electrophoresed in NuSieve 3:1 agarose (Lonza 50091), and fragments sized 150-350 bp were excised and then purified using a MinElute Gel Extraction kit (QIAGEN 28604) ...
-
bioRxiv - Microbiology 2023Quote: ... The RNA was loaded onto a 2% NuSieve 3:1 agarose (Lonza), 1X MOPS ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2019Quote: ... supplemented with 8 mM L-Glutamine (Lonza) and 1 μL per mL anti-clumping agent (Life Technologies) ...
-
bioRxiv - Cell Biology 2021Quote: ... Human primary hepatic stellate cells from donors 3 and 4 were purchased as isolated hepatic stellate cells from Lonza (cat# HUCLS). Donor information is listed below.