Labshake search
Citations for Lonza :
651 - 700 of 1401 citations for 7 methoxy 4 piperidin 1 ium 1 ylmethyl 3 4 dihydro 2H 1 benzoxepin 5 one chloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: Murine L929 cells (ATCC CCL-1) were maintained in Eagle’s minimal essential medium (MEM) (Lonza) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2021Quote: ... We used the Human Stem Cell Nucleofector Kit-1 and a Nucleofector 2b Device (Lonza) to transfect the plasmids and oligonucleotide donor DNA ...
-
bioRxiv - Cell Biology 2021Quote: ... placed on Lo-Flo SD + 1% agarose pad (SeaKem ® Gold Agarose, Lonza, Rockland, ME) supplemented with 15 μg/mL nocodazole and 1 mM auxin ...
-
bioRxiv - Bioengineering 2022Quote: ... Cells were resuspended in P3 Primary Cell Nucleofector™ Solution containing Supplement 1 (Lonza, Switzerland) and 1 µg of chemically modified sgRNA (Synthego ...
-
bioRxiv - Microbiology 2021Quote: ... 1% 10 mM HEPES in 0.85% NaCl (17-737E, Lonza, BioWhittaker®, Walkersville, MD, USA) and 100 U/ml Penicillin-100 µg/ml Streptomycin (15140-122 ...
-
bioRxiv - Microbiology 2019Quote: ... cells were spotted onto pads made of 1% SeaKem LE Agarose (Lonza, Cat. No. 50000) in PYE and topped with a glass coverslip ...
-
bioRxiv - Genomics 2021Quote: ... 100 units of potassium penicillin and 100 μg of streptomycin sulfate per 1 ml (Lonza). Four and eight T75 cell culture flasks were used for the ERS2312967 and ERS1870077 samples ...
-
bioRxiv - Immunology 2020Quote: ... Cells were resuspended at 1×106 cells/ml in XH media (X-Vivo 15 (Lonza) with 5% human serum ...
-
bioRxiv - Immunology 2021Quote: ... 1% penicillin-streptomycin (penicillin 50 U/ml and streptomycin 50 μg/ml, final concentration; Lonza) at 37 °C with 5% CO2 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1 million hESCs were resuspended with 100uL Lonza Amaxa P3 nucleofection solution (Lonza V4XP-3024), the annealed ...
-
bioRxiv - Immunology 2022Quote: ... For larger scale electroporation in the 1 ml scale of Nucleocuvette Cartridge (Lonza, V4LN-7002), reactions were scaled up 10 fold for cell suspension ...
-
bioRxiv - Neuroscience 2023Quote: ... Those that were positive were individually mounted in 1% low melting point agarose (50100, Lonza) and imaged on a Zeiss LSM 980 confocal microscope using a 20x (NA=0.5 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and Panc-1 (ATCC #CRL-1469) were cultured in D10 media: DMEM (Lonza #12-614Q) supplemented with 10% FBS ...
-
bioRxiv - Genomics 2023Quote: ... Both vectors were also transfected as background controls (1 µg) with pmaxGFP (9 µg, Lonza). 24 hours post nucleofection ...
-
bioRxiv - Cancer Biology 2023Quote: All cultures were routinely (every 1-2 months) tested for mycoplasma contamination using MycoAlert (Lonza). Autosomal STR profiles for cell line authentication were performed by the University of Arizona Genetics Core.
-
bioRxiv - Microbiology 2023Quote: ... 1% 10 mM HEPES in 0.85% NaCl (17-737E, Lonza, BioWhittaker®, Walkersville, MD, USA), 1% antibiotic-antimycotic ...
-
bioRxiv - Neuroscience 2023Quote: ... After reaching 70% confluency by co-transfection with 1 µg of pmaxGFP control cDNA (Lonza), the transfected cells were cultured for an additional 48 h before use.
-
bioRxiv - Cancer Biology 2023Quote: ... and 1 x 106 cells were resuspended in 100 μL of NHDF Nucleofector Solution (Lonza). The cell suspension was then combined with the CRISPR transfection solution and gently mixed prior to electroporation on an Amaxa Nucleofector 2b (Lonza ...
-
bioRxiv - Microbiology 2024Quote: ... Erythrocyte cultures were established in 6 well plates using HL-1 medium (Lonza, Basel, Switzerland) supplemented with 20% human serum type A+ (Interstate Blood Bank) ...
-
bioRxiv - Bioengineering 2024Quote: ... For larger scale electroporation in the 1 ml scale of Nucleocuvette Cartridge (Lonza, V4LN-7002), reactions were scaled up 10-fold for cell suspension ...
-
bioRxiv - Microbiology 2024Quote: ... THP-1 cell line was routinely tested for mycoplasma contamination (Mycoalert mycoplasma detection kit, LONZA). To differentiate monocytic THP-1 into adherent macrophages ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5 µg of PX459 gRNA vector (5’-GACTCCAGTCTTTCTAGAAGA-3’) were nucleofected with the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-100) using program A-30 in the XRep ...
-
bioRxiv - Developmental Biology 2020Quote: ... The red blood cell lysis was performed by resuspending the pellet in 2 ml sterile ACK (Ammonium-Chloride-Potassium) lysis buffer (ACK Lysing Buffer, Lonza) and incubating on ice for 5 minutes ...
-
bioRxiv - Immunology 2019Quote: ... The superior right lung lobe was mashed through a cell strainer and treated with Ammonium-Chloride-Potassium (ACK) lysis buffer (10-5483, Lonza). Cells were pelleted ...
-
bioRxiv - Systems Biology 2022Quote: ... The red blood cell lysis was performed by resuspending the pellet in 2 ml sterile ACK (Ammonium-Chloride-Potassium) lysis buffer (ACK Lysing Buffer, Lonza) and incubating on ice for 5 minutes ...
-
bioRxiv - Immunology 2023Quote: ... The volume of blood was determined and red blood cells were removed using ammonium-chloride-potassium (ACK) lysis buffer (Lonza) prior to antibody staining for flow cytometry analysis.
-
bioRxiv - Immunology 2023Quote: ... Cells were harvested on day 7 with 1X PBS EDTA (Lonza).
-
bioRxiv - Cancer Biology 2019Quote: ... Animals were sacrificed by cervical dislocation four days after electroporation and resected xenografts were fixed in 4% (w/v) paraformaldehyde (PFA) in phosphate buffered saline (PBS) (Lonza, Basel, Switzerland) at 4°C for approximately one week ...
-
bioRxiv - Immunology 2020Quote: ... 106 cells per condition were nucleofected with 4 µg of DNA using the Amaxa Nucleofector II (Lonza, Kit R; program R-024). Nucleofected cells were allowed to recover for 24-48 hours before sorting for GFP positivity and lack of CD56 expression.
-
bioRxiv - Cancer Biology 2019Quote: ... 2×105 cells were co-transfected with 2ug of the Cas9/sgRNA vector PxHF1* and 4 ul of ssODN HDR template (20 uM) using a Lonza X-Unit Nucleofector with P3 buffer kit (Lonza #V4XP-3032). Four days following transfection ...
-
bioRxiv - Immunology 2022Quote: ... puromycin containing medium were changed and every 4 days cells were fed EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (LONZA) supplemented with GlutaMax (ThermoFisher ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... droplets in 6 well plates and treated with retinoic acid for 4 days followed by hepatocyte growth media (Hepatocyte Culture Medium BulletKit (Lonza, CC-3198) supplemented with 10 ng/mL hepatocyte growth factor (PeproTech ...
-
bioRxiv - Bioengineering 2024Quote: ... RNP’s and DNA were electroporated (EP) into T-cells in 16 well EP cuvettes on a 4-D Nucleofector X unit (Cat # V4XP-3032, Lonza, Walkersville, VA) using pulse code EH-115 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Cancer Biology 2021Quote: ... Drug solutions were removed and wells washed twice with 1 x phosphate buffered saline (PBS; Lonza). Fresh Complete
-
bioRxiv - Bioengineering 2019Quote: ... they were partially embedded in a thin layer of 1% low-melting point agarose (SeaPlaque, Lonza) dissolved in physiological saline ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... were obtained from Lonza and maintained in endothelial cell basal medium-2 plus 1% FBS and essential growth factors (Lonza).
-
bioRxiv - Genomics 2020Quote: ... G8PPD-coding plasmid (1 μg) was mixed with re-suspended K562 cells and nucleofected by Lonza 4D nucleofector with program FF-120 ...
-
bioRxiv - Immunology 2020Quote: ... and CD59 (deficient HAP-1 cells) (21) were cultured in Iscove’s Modified Dulbecco’s Medium (IMDM; Lonza) supplemented with 10% (v/v ...
-
bioRxiv - Immunology 2019Quote: ... murine lymphocytes were resuspended at 3.5×106 cells/mL in supplemented HL-1 media (Lonza, UK) (1% L-glutamine ...
-
bioRxiv - Cell Biology 2019Quote: ... 1 µg of plasmid was transfected using a Nucleofector 2b device (Kit V; Lonza, Basel, Switzerland).
-
bioRxiv - Synthetic Biology 2021Quote: ... Horizontal electrophoresis of DNA was carried out using 1% Seakem LE agarose gels (Lonza, Basel, Switzerland). All cloning and molecular biology experiments were carried out according to established protocols ...
-
bioRxiv - Bioengineering 2020Quote: Liver-Chips were stained in the upper channel with AdipoRed (1:40 dilution in PBS, Lonza) to visualize lipid droplet accumulation ...
-
bioRxiv - Immunology 2022Quote: ... 1 × 106 cells were transfected with 8 μg ScaI-linearized plasmid using the Amaxa Nucleofector (Lonza) SF kit on program DS-113 ...
-
bioRxiv - Microbiology 2021Quote: ... as well as the standard LdBPK_282 cl4 using the Basic Parasite Nucleofector™ Kit 1 (Lonza) with the U-033 program ...
-
bioRxiv - Synthetic Biology 2020Quote: ... then embedded in a lateral orientation in 1% low melting point agarose (NuSieve GTG agarose, Lonza), and allowed to polymerize in with cover glass (no ...
-
bioRxiv - Immunology 2019Quote: ... This vector was electroporated into 1×10 B16.F10.Ova cells suspended in Solution V (Lonza) using the Amaxa 2B nucleofector (Lonza ...
-
bioRxiv - Microbiology 2020Quote: ... Chromosomes were separated by pulsed-field electrophoresis for 260 hours in 1% Seakem Gold agarose (Lonza) at 1.5 V/cm in a CHEF-DRII system (Biorad ...
-
bioRxiv - Genetics 2019Quote: 1 liter of Sf9 insect cells grown in Spinner Cultures in BioWhitaker Insect-XPRESS media (Lonza) supplemented with 5% FBS (Sigma ...