Labshake search
Citations for Lonza :
701 - 750 of 1134 citations for 7 Oxabicyclo 4.1.0 heptane 3 carboxylicacid 2 ethylhexyl ester since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... grown to 1.6-2 million cells/ml in Insect-XPRESS media (Lonza™), were infected with P1 viral stocks at 16 ml/L ...
-
bioRxiv - Cell Biology 2022Quote: ... supplemented with the Endothelial Growth Medium (EGM-2) bullet kit (CC-3162, Lonza) and 1x antibiotic-antimycotic (Gibco) ...
-
bioRxiv - Bioengineering 2019Quote: ... Saos-2 cells (ATCC, UK) were cultured in McCoy’s 5A medium (Lonza, USA) supplemented with FBS (15% ...
-
bioRxiv - Genomics 2020Quote: ... The first consisted of 2 μl/well pmaxGFP DNA (LONZA,1 μg/ul) diluted in 250 μl/well Opti-MEM® medium (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... HSC-2 (JCRB0622) cells were cultured in EMEM (Eagle’s Minimum Essential Medium; Lonza), while HO-1-N-1 (JCRB0831 ...
-
bioRxiv - Immunology 2020Quote: RAW264.7 and 293 TLR4/CD14/MD-2 cells were cultured in DMEM (Lonza) supplemented with 10 % FBS (Gibco ...
-
bioRxiv - Cell Biology 2020Quote: ... Samples were collected after two days in SKGM (SKGM-2, Lonza CC-3245) culture ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with Endothelial Cell Growth Medium (EGM)-2 Bullet Kit (CC-3162; Lonza)) ...
-
bioRxiv - Cell Biology 2021Quote: ... The hMBs were maintained in Skeletal Muscle Growth Media-2 (CC-3245; Lonza) as a growth medium for hMBs (hMB-GM) ...
-
bioRxiv - Cancer Biology 2021Quote: ... were obtained from Lonza and were cultured in EGM-2 SingleQuot Kit media (Lonza, cat #CC-3162) and used at passage 2-10 ...
-
bioRxiv - Microbiology 2021Quote: ... cells were overlaid with 1:1 mixture of 2% agarose (Lonza, Basel, Switzerland) and 2X MEM medium ...
-
bioRxiv - Bioengineering 2022Quote: ... that was supplemented with EGM™-2 SingleQuots™ supplements (LONZA, CC-4176), 10 % FCS and 1 % P/S ...
-
bioRxiv - Molecular Biology 2022Quote: ... HAECs were cultured in EBM-2 supplemented with singleQuots (LONZA, Clonetics CC-4176) and Endothelial Cell Growth Kit-VEGF (ATCC ...
-
bioRxiv - Microbiology 2022Quote: Human corneal epithelial cells (hTCEpi) (67) were cultured in KGM-2 (Lonza, USA) supplemented with 1.15 mM calcium chloride (high-calcium ...
-
bioRxiv - Molecular Biology 2022Quote: ... and the recommended growth supplements (FGM™-2 SingleQuots™, CC-4126, Lonza). Primary human skin fibroblasts (2320 ...
-
bioRxiv - Molecular Biology 2022Quote: ... separated on a 2% or 4% agarose gel (Seakem LE agarose, Lonza #50004) by electrophoresis (120 V ...
-
bioRxiv - Bioengineering 2022Quote: ... LECs were cultured in EGM™-2 endothelial growth medium (Lonza, Basel, Switzerland). Primary HSCs were collected after selecting Kupffer cells and LECs ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were cultured in Endothelial Cell Growth Medium-2 BulletKit (CC-3162, Lonza) with 100 U/ml Penicillin (Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2023Quote: ... Preadipocyte cells were maintained in preadipocyte growth media-2 (Lonza Cat #PT-8002). For experiments ...
-
bioRxiv - Physiology 2023Quote: ... Preadipocyte cells were maintained in preadipocyte growth media-2 (Lonza Cat #PT-8002).
-
bioRxiv - Bioengineering 2023Quote: ... cultured according to supplier’s directions in supplemented EBM-2 endothelial basal medium (Lonza); and normal human astrocytes (NHAs ...
-
bioRxiv - Biophysics 2023Quote: ... 95% humidity and 5% CO2 in Fibroblast Growth Medium (FGM-2, Lonza, Basel).
-
bioRxiv - Bioengineering 2022Quote: ... Pre-adipocyte spheroids were maintained in pre-adipocyte growth medium (PGM-2, Lonza) containing 10% fetal bovine serum (FBS) ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK STIM1/2-/- were transfected via electroporation using the Amaxa Nucleofector II (Lonza) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... on 0.2% gelatin-coated plates with EGM-2 bulletkit medium (Lonza, Basel, Switzerland), containing EBM-2 basal medium along with the EGM-2 singlequots kit components ...
-
bioRxiv - Physiology 2023Quote: ... Switzerland) and supplemented with Microvascular Endothelial Cell Growth Medium-2 Bullet Kit (Lonza).
-
bioRxiv - Neuroscience 2023Quote: ... The squares were incubated for 2 minutes with L7 hPSC passaging solution (Lonza). After aspirating the L7 solution ...
-
bioRxiv - Bioengineering 2023Quote: ... were cultured at 37°C and 5% CO2 with EBM-2 medium (Lonza) and EGM-2MV supplements in T-75 flasks until confluent ...
-
bioRxiv - Molecular Biology 2023Quote: ... HPAECs were cultured for 4 hours in endothelial basal medium (EBM-2, Lonza) with 2% FBS ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 x 105 cells were resuspended in 20 µL Nuclofector Solution SF (Lonza), combined with the assembled Cas9 RNPs ...
-
bioRxiv - Cancer Biology 2023Quote: 2.5 x 105 HUVEC (< 6th passage) in 120 µL EGM-2 media (Lonza) were seeded in channel slides (µ-Slides 0.4 Luer ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2-4 x 105 cells were resuspended in 100uL of P2 medium (Lonza) containing 10 µg of Cas9 or Cas9/guide plasmidic DNA and transferred to a cuvette (Lonza) ...
-
bioRxiv - Microbiology 2020Quote: ... Infected CD4 T cells were washed with PBS and 3 million cells per condition were resuspended in 20uL buffer P2 (Lonza) with 4μM IDT electroporation enhancer ...
-
bioRxiv - Immunology 2022Quote: ... Thawed PBMCS were rested for 3-4h at 37°C in X-VIVO 15 Serum-free Hematopoietic Cell Medium (Lonza) supplemented with 5% human Ab serum ...
-
bioRxiv - Biochemistry 2019Quote: ... 3×107 cells were transfected with 10 μg of NotI linearized plasmids using the AMAXA electroporator (Lonza, program X-001) as described [14] ...
-
bioRxiv - Genetics 2020Quote: ... ∼1×106 cells were transfected with pairs of 5 µg gRNA plasmid and 4 µg ssODN (Supplementary Table 3) using AmaxaTM Human CD34 Cell NucleofectorTM Kit (Lonza) in the 2B-NucleofectorTM on the U-08 setting ...
-
bioRxiv - Neuroscience 2020Quote: ... The spinal cord was spun at 3000 rpm for 3 min at room temperature after which the embryonic medium was replaced with 1x trypsin-EDTA (Lonza). The tissue was macerated in trypsin and incubated at 37°C for 15-20 mins ...
-
bioRxiv - Microbiology 2021Quote: ... Viral supernatants were collected 3 and 6 days post-infection and induced-cell death and viral titers were determined in the ToxiLight Bioassay (Lonza) and PFA ...
-
bioRxiv - Molecular Biology 2020Quote: ... at Day 3-4 of phase I culture were electroporated using P3 Primary Cell 4D NucleofectorTM X Kit (from Lonza) with program DZ100 (Bak et al. ...
-
PSGL-1 inhibits HIV-1 infection by restricting actin dynamics and sequestering HIV envelope proteinsbioRxiv - Microbiology 2020Quote: ... 1×106 activated CD4+T cells were stimulated by IFN-γ for 24 h before being transfected with 3 siRNAs following Amaxa Nucleofector following the manufacturer’s protocols (Lonza). Two days post transfection ...
-
bioRxiv - Cell Biology 2022Quote: ... and diseased COPD human lung fibroblasts (DHLFs) from 3 donors (donor IDs: OF3353, OF3418 and OF3238) were purchased from Lonza and tested for their response to FGF2 and TGFβ stimulation.
-
bioRxiv - Cancer Biology 2022Quote: ... and then combined with 3 µL of RNP mixture and nucleofected using program DJ-110 (melanoma) or EH100 (TILs) on a 4D Nucleofector (Lonza). Melanoma cells were immediately recovered in full melanoma media in 12-well plates ...
-
bioRxiv - Immunology 2021Quote: ... 2.106 T cells were resuspended in 20 µl of nucleofection solution with 3 µl or 4 µl RNP and transferred to Nucleofection cuvette strips (4D-Nucleofector X kit S; Lonza). Murine T cells were electroporated using the DN110 program of 4D nucleofector (4D-Nucleofector Core Unit ...
-
bioRxiv - Immunology 2019Quote: ... A20 and A20 D1.3 B cells (3 × 106cells) were transiently transfected using the AMAXA nucleofector kit V (Lonza, #VCA-1003) or the Ingenio electroporation kit (Mirus ...
-
bioRxiv - Cell Biology 2021Quote: ... were isolated from healthy donors (n=3) as described[4] and seeded on 6 cm dishes within BEGM media (Lonza) before transduction with lentivirus (empty vector (Origene ...
-
bioRxiv - Microbiology 2021Quote: ... The human lung epithelial cell line Calu-3 (ATCC HTB-55) was maintained in DMEM F-12 (Lonza, Basel, Switzerland) supplemented with 10% FBS ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5.0-8.0 × 105 BTAG cells were electroporated with 3 μg of each gRNA using Amaxa 4D nucleofector (Lonza, V4XP-3012) and the CA-137 program ...
-
bioRxiv - Bioengineering 2023Quote: Ha deposition was detected staining constructs sections (n≥10 from n≥3 chambers considering two different hACs and two different MSCs donors) with OsteoImage (Lonza) as detailed above ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Measured tissues originated from six F508del homozygous patients (CF patient #1: CF-AB0609, female, 31 years-old; CF patient# 3: #28388-0000450918, Lonza, male ...