Labshake search
Citations for Lonza :
151 - 200 of 931 citations for 7 Oxa 3 azabicyclo 4.1.0 heptane 1 methyl 3 propyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2023Quote: ... The PCR products were then loaded and migrated by electrophoresis on a 3% Tris-borate-EDTA (TBE) agarose gel supplemented with GelStar Nucleic Acid Gel Stain (Lonza) for approximately one hour ...
-
bioRxiv - Immunology 2024Quote: ... They were then transfected by nucleofection with 3 μg of plasmid DNA in 100 μl of Cell Line Nucleofector Solution V (Lonza) using the V-001 program (Amaxa Biosystems) ...
-
bioRxiv - Neuroscience 2019Quote: COS-7 cells were maintained in DMEM (Lonza) supplemented with 10 % FBS (Sigma) ...
-
bioRxiv - Cell Biology 2021Quote: ... Human primary hepatic stellate cells from donors 3 and 4 were purchased as isolated hepatic stellate cells from Lonza (cat# HUCLS). Donor information is listed below.
-
bioRxiv - Cancer Biology 2020Quote: ... dissociated into single cell suspension with trypsin-EDTA (Pan-Biotech, Germany) for 3 min followed by trypsin neutralizing solution (Lonza, Germany). Single cell suspensions of secondary mammospheres were obtained as described for day 7-first generation mammospheres.
-
bioRxiv - Immunology 2022Quote: ... were transfected with 0.1 nmol of siRNA oligonucleotides (listed in Supplementary Table 3) using a Human Monocyte Nucleofactor Kit (Lonza, VVPA-1007) and the AMAXA Nucleofector System (Lonza ...
-
bioRxiv - Developmental Biology 2019Quote: ... 4 μg of the donor ssDNA and 3 μg of a puromycin resistance plasmid (pCAG-puroR) using the Mouse ES Cell Nucleofector™ Kit (Lonza) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... Slices were immediately placed in a 6-well plate containing 3 mL per well of “complete RPMI”: RPMI (Lonza, 16-167F) supplemented with 10 % FBS (VWR ...
-
bioRxiv - Molecular Biology 2024Quote: ... All cell lines were confirmed to be mycoplasma negative every 3 weeks (MycoAlert™ Mycoplasma Detection Kit, Lonza, Bend, OR, USA). Fifteen micrograms of total whole cell lysates (WCL ...
-
bioRxiv - Genetics 2023Quote: ... The RNP complex together with 7 µg of donor DNA was nucleofected into 3 × 107 ISE6 cells using EN150 and buffer SF via the 4D-Nucleofector system (Lonza Bioscience) (Figure S1) ...
-
bioRxiv - Bioengineering 2024Quote: ... Cells were cultured at passage 3 and seeded in triplicate in hMSC Growth Medium (MSCGM™ Mesenchymal Stem Cell Growth Medium, Lonza) with 10% FBS ...
-
bioRxiv - Immunology 2024Quote: ... were transfected with 0.1 nmol of siRNA oligonucleotides (listed in Extended Data Table 3) using a Human Monocyte Nucleofactor Kit (Lonza, VVPA-1007) and the AMAXA Nucleofector System (Lonza ...
-
bioRxiv - Immunology 2021Quote: ... Cells were differentiating for 7 days in DMEM (Lonza) supplemented with 25% of L929 medium ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5 µg of PX459 gRNA vector (5’-GACTCCAGTCTTTCTAGAAGA-3’) were nucleofected with the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-100) using program A-30 in the XRep ...
-
bioRxiv - Developmental Biology 2021Quote: ... 4 μg of the donor ssDNA and 3 μg of a puromycin resistance plasmid (pCAG-puroR) using the Mouse ES Cell Nucleofector™ Kit (Lonza, Switzerland) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... Cell lines are cultivated at 37°C with 5% CO2 and were tested every 3 months for mycoplasma contamination using Universal Mycoplasma detection kit (ATCC, 30-1012K) or MycoAlert Plus Mycoplasma Detection Ki (Lonza, LT07-701). Cell lines were used no more than 30 passages.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... A high resistance Plastiape® RS00 inhaler (Plastiape S.p.A, Osnago, Italy) containing size #3 HPMC capsules (V-Caps® Plus, Lonza, Morristown, NJ) and 1-3 mg of powder was attached to a USP induction port by a molded silicon adapter ...
-
bioRxiv - Immunology 2020Quote: ... Transfection of primary T cells with Cas9 RNP complexes and TCRβα HDR templates was performed 3-4 days following activation using the 4D-Nucleofector and a 20 uL format P3 Primary Cell kit (Lonza, V4XP-3032). Briefly ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... were seeded onto 96-well plates at a density of 3×104 cells per well in 100 μL cell culture media that consisted of DMEM (Lonza, Basel, Switzerland), 1% penicillin–streptomycin (Lonza ...
-
bioRxiv - Microbiology 2023Quote: ... Full-thickness samples were obtained by 12 mm punch and placed in 12-well plates containing 3 mL Dulbecco’s Modified Eagle Medium (DMEM) (Lonza, Walkersville, MD, USA) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were regularly passaged 2-3 times a week and routinely tested for mycoplasma contamination using MycoAlert Plus mycoplasma Detection kit (Lonza, #LT07-710).
-
bioRxiv - Genomics 2024Quote: ... and electroporated with 6 μg of gRNA-Cas9 expression vector and 3 μg of SNRPN targeting vector using the P3 Primary Cell 4D-Nucleofector Kit (Lonza, V4XP-3032). Transfected cells were plated into a 10 cm dish coated with Matrigel (Corning ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Five milligrams of niclosamide inhalation powder was loaded into size #3 hydroxypropyl methylcellulose capsules (Vcaps® plus, Capsugel®, Lonza, Morristown, NJ, USA). The aerodynamic properties of the powder were evaluated using a Next Generation Impactor (NGI ...
-
bioRxiv - Neuroscience 2022Quote: ... Harvested EBs were transferred to a tissue-culture treated 6-well plate (Falcon, #353224) in 3 ml of EB Differentiation media: X-VIVO 15 (Lonza Biosciences, #04-418Q) + 1% Glutamax (Life Technologies ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Biochemistry 2020Quote: COS-7 cells were cultured in 50/50 DMEM (Lonza)/Ham’s F10 (Lonza ...
-
bioRxiv - Developmental Biology 2019Quote: ... embryos were embedded in 7% low-melting point agarose (Lonza) and sagittal tissue sections at 100 µm thickness were cut on a VT1000S vibratome (Leica) ...
-
bioRxiv - Genomics 2020Quote: ... Human umbilical vein endothelial cells were isolated from umbilical cords of healthy donors after cesarean sections (HUVECS; n = 4; RWTH Aachen) (55) or obtained from Lonza (n = 3, Basel, Switzerland) (8) ...
-
bioRxiv - Genetics 2021Quote: Human embryonic microglia clone 3 (HMC3, ATCC® CRL3304™) cells were cultured in minimum essential medium (MEM) Eagle-EBSS with NEAA without L-Glutamine (Lonza, Cologne, Germany) supplemented with 10% fetal bovine serum (Sigma-Aldrich ...
-
bioRxiv - Immunology 2023Quote: ... Cells were harvested on day 7 with 1X PBS EDTA (Lonza).
-
bioRxiv - Pharmacology and Toxicology 2021Quote: About three milligrams of AUG-3387 mAb dry powder was loaded into size #3 hydroxypropyl methylcellulose (HPMC) capsules (Vcaps® plus, Capsugel®, Lonza, Morristown, NJ, USA). The aerodynamic properties of the powder were evaluated using a Next Generation Impactor (NGI ...
-
bioRxiv - Genomics 2022Quote: ... 1.0µg/µl SpCas9-sgRNA-PGK-Venus construct and 1µg/µl donor construct were nucleofected into ∼3×106 Tir1 mESCs using the Amaxa™ 4D-Nucleofector and the P3 Primary Cell 4D-Nucleofector™ X Kit (Lonza, Cat. V4XP-3024) following the manufacture’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: COS-7 and U2OS cells were grown in DMEM (Lonza, 12-604F) supplemented with 10% fetal calf serum (FCS ...
-
bioRxiv - Bioengineering 2019Quote: ... MCF-7 cells were cultured in DMEM low glucose medium (Lonza, USA) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2020Quote: ... After 5-7 days of expansion with BEGM media (Lonza #CC-3170), air-liquid interface (ALI ...
-
bioRxiv - Bioengineering 2023Quote: Primary human umbilical vein endothelial cells (HUVECs; Lonza; passages 4 to 7) were cultured on dishes in Endothelial Cell Growth Medium-2 (EGM-2 ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293T cells and COS-7 cells (ATCC) were cultured in DMEM medium (Lonza) supplemented with 10% fetal calf serum (FCS ...
-
bioRxiv - Bioengineering 2023Quote: ... were expanded to passage 6 or 7 in endothelial growth media (EGM-2 BulletKit, Lonza), and culture medium was changed every other day ...
-
bioRxiv - Cell Biology 2020Quote: ... and 7 mM Na2HPO4 in nuclease-free water) using either the Amaxa nucleofector system II (Lonza) under nucleofection program T-005 or the Amaxa 4Dnucleofector system (Lonza ...
-
bioRxiv - Neuroscience 2021Quote: ... 7 µg mRNA was transfected into 0.5× 106 fibroblasts using Cell Line Nucleofector Kit V (Lonza) and AMAXA program X-001 following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: MCF-7 and MDA-MB-231 (ECACC) were cultured in Dulbecco’s Modified Eagle Medium (DMEM) (Lonza, Manchester, UK), supplemented with 10% (v/v ...
-
bioRxiv - Immunology 2021Quote: ... On day 7 cells were nucleofected using the Amaxa Mouse T Cell Nucleofector Kit (Lonza, Cat no. VVPA-1006) per the manufacturer’s instructions with 5x106 cells and 1.5µg plasmid DNA per cuvette ...
-
bioRxiv - Bioengineering 2023Quote: ... rinsed 3 times with 1x Dulbecco’s phosphate buffered saline (DPBS) (Formulation: 200mg/L KCl and KH2PO4, 8000mg/L NaCl, 2160mg/L Na2HPO4*7H2O, pH 7-7.6,) (BioWhittaker, Lonza) fixed with 3.7% paraformaldehyde solution prior to running in flow cytometer (Guava easyCyte 6HT ...
-
bioRxiv - Genetics 2023Quote: ... IMR90 fetal lung fibroblasts at passage 7 were cultured in FGM-2 lung fibroblast basal media (Lonza, #CC-3131) according to the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2019Quote: ... at passages 4-7 were grown to confluence on gelatin-coated plates and maintained using complete EGM-2 media (Lonza). HKi002 was maintained at room temperature for 30 min rotating before use ...
-
bioRxiv - Bioengineering 2020Quote: ... About 2–4 passages of primary keratinocytes were made in culture in 37°C in a 7 % CO2 incubator with KBM-Gold supplemented with KGM-Gold Single Quots (Lonza) medium to 80% confluence in 100 mm Petri dishes ...
-
bioRxiv - Microbiology 2021Quote: ... Raw264.7 Ifit2 CRISPR cells were generated by electroporating low passage Raw264.7 cells with Ifit2 pSBtet-puro-Cas9-U6 using Amaxa Nucleofector II and Amaxa Cell Line Nucleofector Kit V (Lonza). Cells were selected with puromycin 3 days post-nucleofection ...
-
bioRxiv - Microbiology 2020Quote: ... fumigatus collected from three 10-cm plates grown for 7 days at 37°C were germinated with shaking in RPMI 1640 (Lonza) liquid media supplemented with glucose to a final concentration of 2% (w/v ...
-
bioRxiv - Developmental Biology 2022Quote: Primary HDLECs were isolated from neonatal human foreskins as described previously (74) and cultured from passages 5 – 7 on fibronectin-coated plates with EGM-2 MV growth media (Lonza) supplemented with human VEGF-C (R&D) ...