Labshake search
Citations for Lonza :
101 - 150 of 1519 citations for 6H Furo 2 3 b pyrrole 5 carboxylicacid 6 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... pre-coated cell culture 6-well plate with EBM-2 endothelial media supplemented with 10% FBS and a growth factor bullet kit (Lonza, Walkersville, USA) 3 mL/well ...
-
bioRxiv - Cancer Biology 2019Quote: ... NSCs were harvested with Accutase and 2-3×106 cells were resuspended in 100µl mouse neural stem cell nucleofector buffer (Lonza) with 2µg plasmid DNA ...
-
bioRxiv - Developmental Biology 2021Quote: ... HESCs were transfected with a total of 4ug DNA in a ratio 2:3 (gRNAs:donor template) using the Amaxa P3 Primary Cell 4D-Nucleofector Kit (Lonza). Puromycin was added 3 days after electroporation at a concentration of 0.5ug/ml ...
-
bioRxiv - Cancer Biology 2024Quote: ... and (iv) the NDF-2 and NDF-3 cell lines (human neonatal dermal fibroblast cell lines, #CC-2509; Lonza Bioscience ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1x Pen/Strep Amphotericin B (Lonza, 17-745E). This line was provided by the Thomson lab and assayed for standard pluripotency markers and had a normal karyotype (supplemental figure 1) ...
-
bioRxiv - Microbiology 2021Quote: ... Penicillin-Streptomycin-Amphotericin B Solution (10ml/l, Lonza, Switzerland).
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... CC-2540S) and cultured in B-ALI medium (Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... The hUVEC cells were cultured and expanded until passage 5 with EGM-2 media (CC-3156, Lonza) and SingleQuot supplements (CC-4176 ...
-
bioRxiv - Bioengineering 2023Quote: Cells were cultured at 37°C and 5% CO2 in cell-specific media: primary human umbilical vascular endothelial cells (HUVECs, Lonza; up to passage 6) in EGM-2 (Lonza ...
-
bioRxiv - Cell Biology 2022Quote: ... All cell lines were tested to be negative for mycoplasma every 2–3 months using the MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Genetics 2020Quote: ... hESCs were nucleofected with 2 μg of CRISPR and 3 μl ssODN (100 μm) using the P3 Primary Cell Kit L (Lonza). hESCs were then plated onto puromycin-resistant (DR4 ...
-
bioRxiv - Cell Biology 2020Quote: ... U–2–OS-pEP15 cells (5) were maintained in 1 mg/ml glucose phenol-red-free DMEM (Lonza) supplemented with steroid-free FBS (Thermo Fisher Scientific) ...
-
bioRxiv - Physiology 2023Quote: ... USA) were cultured in 5% fetal bovine serum containing endothelial cell growth medium (EGM-2; Lonza, Basel, Switzerland). Media was supplemented with heparin ...
-
bioRxiv - Developmental Biology 2022Quote: ... using the B-016 program of the 4D-Nucleofector (Lonza) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... Isolated B-cells were kept on ice in DMEM (Lonza) supplemented with 0.6% BSA (Thermo Fisher Scientific) ...
-
bioRxiv - Bioengineering 2022Quote: ... GM-3TM Lymphocyte Growth Medium-3 (LGM-3™) (Lonza), Opti-MEM Serum-Free medium (Thermofisher) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5 µg of PX459 gRNA vector (5’-GACTCCAGTCTTTCTAGAAGA-3’) were nucleofected with the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-100) using program A-30 in the XRep ...
-
bioRxiv - Bioengineering 2019Quote: ... The plate containing the amplified genes or qPCR products was kept in ice and observed in a 2% agarose gel (NuSieve® 3:1 Agarose (Lonza)) to check and reinforce the identity of the amplicons ...
-
bioRxiv - Microbiology 2021Quote: ... HXGPRT amplicon (2-5 µg) into 1x106 RH TIR1-3FLAG tachyzoites in P3 buffer using a 4D-nucleofector (Lonza) with pulse code FI-158 ...
-
bioRxiv - Immunology 2022Quote: ... were coated overnight at 4°C with 25μL of SEC fractions 1 to 5 diluted 1:2 with PBS (Cat. No. LZBE17-512F, Lonza). Wells were washed with 0.05% Tween-20 (Cat ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Systems Biology 2019Quote: ... and 1% penicillin-streptomycin-amphotericin B solution (Lonza, Walkersville, MD, USA). Cells were grown on Matrigel (BD Biosciences ...
-
bioRxiv - Bioengineering 2021Quote: ... All media contained 1% Penicillin-Streptomycin-Amphotericin B mixture (Lonza, Switzerland) as well ...
-
bioRxiv - Cell Biology 2021Quote: ... 1% NEAA and 1x Pen/Strep Amphotericin B (Lonza, 17-745E). For feeder-free culture ...
-
bioRxiv - Biophysics 2022Quote: ... 1 ml Penicillin-Streptomycin-Amphotericin B Mixture (PSF, Lonza 17-745E)) ...
-
bioRxiv - Immunology 2022Quote: ... B cells were cultured with RPMI-1640 medium (Lonza, Basel, Switzerland) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were regularly passaged 2-3 times a week and routinely tested for mycoplasma contamination using MycoAlert Plus mycoplasma Detection kit (Lonza, #LT07-710).
-
bioRxiv - Microbiology 2023Quote: ... 6 mmol/L l-glutamine (Lonza®), and a mixture of penicillin/streptomycin (100U/100 μg/mL ...
-
bioRxiv - Developmental Biology 2022Quote: Primary HDLECs were isolated from neonatal human foreskins as described previously (74) and cultured from passages 5 – 7 on fibronectin-coated plates with EGM-2 MV growth media (Lonza) supplemented with human VEGF-C (R&D) ...
-
bioRxiv - Microbiology 2019Quote: ... All experiments were done with cells at passage 2 to 5 and cells were regularly checked for mycoplasma contamination (MicoAlert Lonza).
-
bioRxiv - Cell Biology 2019Quote: ... HUVE cells were cultured in endothelial growth medium supplemented with 5% fetal bovine serum (FBS) and growth factors (EGM-2; Lonza). HEK293T cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM ...
-
bioRxiv - Immunology 2021Quote: Human telomerase-immortalized corneal epithelial (hTCEpi) cells (26) were maintained at 37°C/5% CO2 in regular keratinocyte growth medium KGM-2 (Lonza). Prior to treatment ...
-
bioRxiv - Immunology 2021Quote: ... CD3/CD28 beads were removed 48 hours after stimulation and 5 × 106 CTLs were electroporated with 2 μg plasmid using 4D-Nucleofector (Lonza). Medium was changed 6 hours after nucleofection and transfected cells were used 24-36 hours after electroporation ...
-
bioRxiv - Developmental Biology 2022Quote: ... Primary MEC were cultured in endothelial growth media (EGM) containing 5% FBS with growth factors (EBM-2; Lonza, Basel, Switzerland) at 37°C in 5% CO2 ...
-
bioRxiv - Genomics 2019Quote: ... HAFTL pre-B cells were cultured in RPMI1640 without phenol red (Lonza) supplemented with 10% charcoal/dextran-treated FBS (Hyclone ...
-
bioRxiv - Physiology 2019Quote: ... 50 ng.mL−1 amphotericin B and 10 μg.ml−1 heparin (BulletKitTM, Lonza). Experiments were performed on cells from passage 2-5 ...
-
bioRxiv - Developmental Biology 2020Quote: ... amphotericin B (50 ng/ml) epidermal growth factor (10 ng/ml) (Lonza) and 10% Fetal Bovine serum (FBS ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were maintained at 37°C in 5% CO2 in either EGM-2 MV complete media (CC-3125, Lonza, Walkersville, MD) or in M199 supplemented with 20% FBS (Atlanta Biologicals ...
-
bioRxiv - Genomics 2019Quote: ... The products were size selected on a 3% NuSieve 3:1 Agarose gel (Lonza), purified using NucleoSpin Gel and PCR clean-up columns ...
-
bioRxiv - Immunology 2019Quote: ... HAE cultures were grown in B-ALI medium supplemented with inducer (Lonza Inc.) at each media change with provision of an air-liquid interface for approximately 6 weeks to form differentiated ...
-
bioRxiv - Developmental Biology 2021Quote: ... Nucleofection was performed with program B-016 on an Amaxa Nucleofector II (Lonza). Cells were then grown for ten days under selection by 1 μg/mL puromycin and 10 μg/mL blasticidin ...
-
bioRxiv - Biophysics 2023Quote: ... 100 units/ml penicillin-streptomycin and 0.25 µg/ml amphotericin B (Lonza, Basel) are added ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.1 μg/mL amphotericin B (Biowest) and 10,000 U/mL penicillin/streptomycin (Lonza). Cells and PDECs were grown in a humidified incubator at 37◦C under 5% CO2 ...
-
bioRxiv - Genetics 2023Quote: Plasmids were transfected using either the 4D Nucleofector (EBV B, Daudi, THP1; Lonza, 4D-Nucleofector Core Unit #AAF-1002B and 4D-Nucleofector X Unit #AAF-1002X) ...
-
bioRxiv - Microbiology 2024Quote: ... Transfection was performed using the Amaxa Nucleofector kit V program B-023 (Lonza) or Xcell PBS protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... and CD31+Rspo3+ cells were centrifuged at 500 g for 5 min and resuspended in 500 μl endothelial cell media: EGM-2 MV Bullet Kit (Lonza, cc-3202) supplemented with 50 ng/mL VEGF-C (R&D ...
-
bioRxiv - Cell Biology 2024Quote: ... coated tissue culture polystyrene (TCPS) and maintained at 37° Celsius and 5% CO2 in endothelial growth medium (EGM-2 with bullet kit; Lonza, CC-3162) supplemented with 1% penicillin/streptomycin (Corning ...
-
bioRxiv - Bioengineering 2023Quote: ... in 6-well tissue culture plates and were allowed to adhere for 5 hours before induction of serum starvation in EBM-2 (LONZA, Cat# CC-3156) for 16 hours prior to being administered media of interest ...
-
bioRxiv - Cell Biology 2021Quote: The A20 B-cell lymphoma line (ATCC #TIB-208) was cultured in DMEM (Lonza) supplemented with 10% of FBS (Thermo Fisher Scientific) ...