Labshake search
Citations for Lonza :
201 - 250 of 601 citations for 6 N CARBETHOXY 3 CHLORO 7 8 DIHYDRO 5H PYRIDO 4 3 C PYRIDAZINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... A high resistance Plastiape® RS00 inhaler (Plastiape S.p.A, Osnago, Italy) containing size #3 HPMC capsules (V-Caps® Plus, Lonza, Morristown, NJ) and 1-3 mg of powder was attached to a USP induction port by a molded silicon adapter ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... were seeded onto 96-well plates at a density of 3×104 cells per well in 100 μL cell culture media that consisted of DMEM (Lonza, Basel, Switzerland), 1% penicillin–streptomycin (Lonza ...
-
bioRxiv - Microbiology 2023Quote: ... Full-thickness samples were obtained by 12 mm punch and placed in 12-well plates containing 3 mL Dulbecco’s Modified Eagle Medium (DMEM) (Lonza, Walkersville, MD, USA) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were regularly passaged 2-3 times a week and routinely tested for mycoplasma contamination using MycoAlert Plus mycoplasma Detection kit (Lonza, #LT07-710).
-
bioRxiv - Genomics 2024Quote: ... and electroporated with 6 μg of gRNA-Cas9 expression vector and 3 μg of SNRPN targeting vector using the P3 Primary Cell 4D-Nucleofector Kit (Lonza, V4XP-3032). Transfected cells were plated into a 10 cm dish coated with Matrigel (Corning ...
-
bioRxiv - Systems Biology 2019Quote: ... supplemented with 8 mM L-Glutamine (Lonza) and 1 μL per mL anti-clumping agent (Life Technologies) ...
-
bioRxiv - Biophysics 2021Quote: ... 2mM L-Glutamine (Lonza, Cat N.: BE17-605E) and 1% Penicillin/Streptomycin (Lonza ...
-
bioRxiv - Cancer Biology 2023Quote: SCM preparation: MEBM (Lonza, cat. n. CC-3153) was supplemented with 1% Penicillin/Streptomycin (100 U/ml) ...
-
bioRxiv - Immunology 2021Quote: ... Buffy coat cells were washed three times in 2.5 mM EDTA-PBS at 4°C before dilution and maintenance in RPMI-1640 supplemented with 10% FCS (PAA, AT or Lonza, CH) 2 mM glutamine ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Five milligrams of niclosamide inhalation powder was loaded into size #3 hydroxypropyl methylcellulose capsules (Vcaps® plus, Capsugel®, Lonza, Morristown, NJ, USA). The aerodynamic properties of the powder were evaluated using a Next Generation Impactor (NGI ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Biochemistry 2020Quote: COS-7 cells were cultured in 50/50 DMEM (Lonza)/Ham’s F10 (Lonza ...
-
bioRxiv - Developmental Biology 2019Quote: ... embryos were embedded in 7% low-melting point agarose (Lonza) and sagittal tissue sections at 100 µm thickness were cut on a VT1000S vibratome (Leica) ...
-
bioRxiv - Cell Biology 2021Quote: ... and cells were isolated by centrifugation at 500 g for 5 min at 4°C followed by being treated with ACK Lysing Buffer (10-548E, Lonza Bioscience, Switzerland) to remove red blood cells ...
-
bioRxiv - Bioengineering 2019Quote: ... and 8 mM L-glutamine (Lonza, Basel, Switzerland). Fed-batch cultivation was performed in a DASGIP Mini bioreactor (Eppendorf ...
-
bioRxiv - Microbiology 2021Quote: An 8% SeaPlaque GTG Agarose (Lonza, Basel, Switzerland) solution in Ultra Pure Water (Genesee Scientific ...
-
bioRxiv - Genetics 2021Quote: Human embryonic microglia clone 3 (HMC3, ATCC® CRL3304™) cells were cultured in minimum essential medium (MEM) Eagle-EBSS with NEAA without L-Glutamine (Lonza, Cologne, Germany) supplemented with 10% fetal bovine serum (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2021Quote: ... and 1% Penicillin/Streptomycin (Lonza, Cat N. DE17-602E), and maintained in cell culture flask (Corning ...
-
bioRxiv - Immunology 2023Quote: ... Cells were harvested on day 7 with 1X PBS EDTA (Lonza).
-
bioRxiv - Pharmacology and Toxicology 2021Quote: About three milligrams of AUG-3387 mAb dry powder was loaded into size #3 hydroxypropyl methylcellulose (HPMC) capsules (Vcaps® plus, Capsugel®, Lonza, Morristown, NJ, USA). The aerodynamic properties of the powder were evaluated using a Next Generation Impactor (NGI ...
-
bioRxiv - Genomics 2022Quote: ... 1.0µg/µl SpCas9-sgRNA-PGK-Venus construct and 1µg/µl donor construct were nucleofected into ∼3×106 Tir1 mESCs using the Amaxa™ 4D-Nucleofector and the P3 Primary Cell 4D-Nucleofector™ X Kit (Lonza, Cat. V4XP-3024) following the manufacture’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... supplemented with 8 mM ultraglutamine (Lonza, #BE17-605E/U1), 1 X HT supplement (Gibco ...
-
bioRxiv - Microbiology 2023Quote: ... 6 mmol/L l-glutamine (Lonza®), and a mixture of penicillin/streptomycin (100U/100 μg/mL ...
-
bioRxiv - Cell Biology 2022Quote: COS-7 and U2OS cells were grown in DMEM (Lonza, 12-604F) supplemented with 10% fetal calf serum (FCS ...
-
bioRxiv - Bioengineering 2019Quote: ... MCF-7 cells were cultured in DMEM low glucose medium (Lonza, USA) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2020Quote: ... After 5-7 days of expansion with BEGM media (Lonza #CC-3170), air-liquid interface (ALI ...
-
bioRxiv - Immunology 2021Quote: ... Cells were harvested on day 7 with 1 X PBS EDTA (Lonza).
-
bioRxiv - Cell Biology 2020Quote: HUVECs (Lonza, C-2519A) were cultured in EGM medium (Lonza ...
-
bioRxiv - Cancer Biology 2023Quote: ... (kit C, W001; Lonza) and CD81 positive cells sorted (ARIA III BD ...
-
bioRxiv - Neuroscience 2022Quote: ... MSCs (2×104 in 6 μl, Lonza, UK) were injected in DMM operated mice at 14 weeks following the surgery ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293T cells and COS-7 cells (ATCC) were cultured in DMEM medium (Lonza) supplemented with 10% fetal calf serum (FCS ...
-
bioRxiv - Bioengineering 2020Quote: ... HUVEC cells were cultured to <8 passages in EBM-2 (Lonza) supplemented with EGM-2 Single Quots (Lonza) ...
-
bioRxiv - Cell Biology 2020Quote: ... 8 and 14 of culture with 70 µL of BEGM** (Lonza). On day 21 ...
-
bioRxiv - Bioengineering 2021Quote: ... HUVECs (Lonza, Passage <4) were cultured in an endothelial growth medium (C-22111 ...
-
bioRxiv - Physiology 2023Quote: ... were purchased from PromoCell (#C-12203 / C-12253) and cultured in endothelial cell basal medium (EBM, #CC-3121, Lonza) supplemented with EGM-SingleQuots (CC-4133 ...
-
bioRxiv - Immunology 2023Quote: ... and cells were harvested on day 7 using 1 X PBS EDTA (Lonza, BE02-017F) for experiments.
-
bioRxiv - Immunology 2022Quote: ... -coated 6-well plates in X-VIVO 15 media (Lonza), supplemented with rhActivin A ...
-
bioRxiv - Biochemistry 2020Quote: ... Tissues were embedded in 6% low-melting point agarose (Lonza) for two minutes on ice ...
-
bioRxiv - Developmental Biology 2021Quote: Passage 1-6 human umbilical vein endothelial cells (HUVEC, Lonza) were cultured in 0.003% Endothelial cell growth supplement (Millipore) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5% (V/V) FCS (LO CC-3202/6, Lonza) up to 70-75% confluency ...
-
bioRxiv - Immunology 2024Quote: ... and used at passage 6 (Lonza, CC-3156 & CC-4147). Primary human brain pericytes were obtained from Cell Systems (ACBRI 498) ...
-
bioRxiv - Bioengineering 2020Quote: ... For transfection 4 × 106 cells/mL cells were resuspended in ProCHO-4 Medium (Lonza) supplemented with 4 mM Ultraglutamine (Lonza) ...
-
bioRxiv - Genomics 2019Quote: Bone marrow aspirates (donor n = 2, female, ages 22 & 24) were purchased from LONZA and hMSCs were isolated by adherence to tissue culture flasks for 24 hours ...
-
bioRxiv - Immunology 2022Quote: ... and then transferred by the N-024 program of Amaxa’s Nucleofector electrotometer (Lonza, Switzerland) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... donors (passage 4-9; Lonza) were grown in complete Endopan-3 medium kit (PAN-Biotech ...
-
bioRxiv - Cell Biology 2023Quote: ... or 4-D nucleofector (LONZA) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: ... 8 and 14 post printing according to the manufacturer’s protocol (Lonza, Basal, Switzerland). See Method supplement for details
-
bioRxiv - Cell Biology 2020Quote: ... and 7 mM Na2HPO4 in nuclease-free water) using either the Amaxa nucleofector system II (Lonza) under nucleofection program T-005 or the Amaxa 4Dnucleofector system (Lonza ...
-
bioRxiv - Neuroscience 2021Quote: ... 7 µg mRNA was transfected into 0.5× 106 fibroblasts using Cell Line Nucleofector Kit V (Lonza) and AMAXA program X-001 following the manufacturer’s instructions ...