Labshake search
Citations for Lonza :
351 - 400 of 1349 citations for 6 Dodecyne 5 8 diol 2 5 8 11 tetramethyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... Cell lines were maintained at 37°C in a humidified incubator containing 95% air and 5% CO2 and routinely tested for mycoplasma contamination with the MycoAlert Assay (Lonza, LT07-418). For experiments requiring manipulation of cystine availability ...
-
bioRxiv - Neuroscience 2023Quote: ... 8 x 105 hiPSCs in single-cell suspension were nucleofected with 5 μg SpCas9-sgRNA plasmid using the P3 Primary Cell 4D-Nucleofector Kit (Lonza, #V4XP-3024) in combination with the 4D Nucleofector Unit X (Lonza ...
-
bioRxiv - Neuroscience 2023Quote: ... All cell lines used in this study were tested mycoplasma free by first culturing the cells for 3-5 days in antibiotic-free media and then subjected to a mycoplasma tested using MycoAlert™ PLUS Mycoplasma Detection Kit (Lonza, UK).
-
bioRxiv - Cell Biology 2023Quote: ... All cells were cultured at 37 °C and 5% CO2 in a humidified incubator and regularly tested for mycoplasma using the MycoAlert mycoplasma detection kit (Lonza, LT07-418).
-
bioRxiv - Cancer Biology 2023Quote: ... Cells lines were maintained in a humidified 37°C incubator with 5% CO2 and routinely tested for mycoplasma contamination (Lonza #LT07-118).
-
bioRxiv - Genomics 2023Quote: ... All cells were cultured with 5% CO2 at 37°C and verified to be free of mycoplasma using the MycoAlert Mycoplasma Detection Kit (Lonza, LT07-218). Wild type MCF7 cells were a gift from Howard Y ...
-
bioRxiv - Molecular Biology 2023Quote: Induced pluripotent stem cells were transfected with a total of 5 μg target Cas9/gRNA plasmids with or without 1 μg repair templates using Human Stem Cell Nucleofector Kit (LONZA, Basel, Switzerland) and Nucleofector 2b device (LONZA ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were electroporated at 5 million cells/100 mL cells per cuvette using a Lonza 4-D nucleofector with pulsecode DP-148 (Lonza, VVPA-1002). Cells were co-cultured for 5 additional days with human astrocyte before transferring cells to homeostatic culture conditions (MGdM media ...
-
bioRxiv - Genomics 2023Quote: The AIDA Data Freeze v1 gene-cell matrix (1,058,909 cells from 503 Japan, Singaporean Chinese, Singaporean Malay, Singaporean Indian, and South Korea Asian donors and 5 distinct Lonza commercial controls), with BCR-seq and TCR-seq metadata ...
-
bioRxiv - Genomics 2023Quote: ... were washed twice with PBS and resuspended in a solution containing a 4.5:5 mixture of nucleofection buffer (Buffer SE, Lonza Lot #: S-09279) and supplement (Lonza ...
-
bioRxiv - Cell Biology 2023Quote: ... Cell lines were cultured in a humidified incubator at 37°C and 5% CO2 and regularly tested for mycoplasma using the MycoAlert mycoplasma detection kit (Lonza, LT07-418).
-
bioRxiv - Microbiology 2024Quote: ... 5 million parasites were electroporated with 5-10ug of digested plasmid with an AMAXA Nucleofector II using X-001 in Human T-cell Nucleofector Solution (Lonza VPA-1002).
-
bioRxiv - Cancer Biology 2024Quote: ... All cells were cultured at 37 °C in 5% CO2 humidity and were tested routinely for mycoplasma using MycoAlert mycoplasma detection kit (Lonza, LT07-318) and appropriate positive control (Lonza ...
-
bioRxiv - Biochemistry 2024Quote: ... All the cells were maintained in a humidified incubator with 5% CO2 at 37 °C and tested negative for mycoplasma by MycoAlert (Lonza, Morristown, NJ). Cells from passage 14-15 (P14-15 ...
-
bioRxiv - Cancer Biology 2020Quote: ... All cell lines were cultured at 37°C and 5% CO2 in DMEM (H3BE12-604F/U1, Lonza Group AG [Cultek S.L.U, Madrid, Spain]) supplemented with 10% tetracycline-free FBS (631106 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Microbiology 2020Quote: ... The final extension step was extended for 5 minutes and product size was confirmed by electrophoresis with a FlashGel™ DNA Kit (Lonza, Basel, Switzerland). PCR products were then purified with the DNA Clean & Concentrator kit ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Cells are spun at 1250 x g for 5 minutes and resuspended in 25 µl Lonza SF buffer (Lonza Cat. No. V4SC-2960) if cycloheximide selection will not be used or 200 µl of SF buffer if cycloheximide selection will be used.
-
bioRxiv - Molecular Biology 2023Quote: ... were grown in 10 cm2 dishes in a humidified environment at 37°C with 5% CO2 in DMEM/F12 medium (Lonza Ltd. Basel, Switzerland) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... were expanded in 10 cm2 dishes in a humidified environment at 37°C with 5% CO2 in DMEM/F12 medium (Lonza Ltd. Basel, Switzerland) supplemented with 12.5% fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2023Quote: ... plates were incubated at 37°C for 30 minutes in blocking buffer (PBS with 1% BSA, 5% FBS, and 1% human AB serum (Lonza, Walkersville, MD, USA), washed three times in PBS with 0.05% tween 20 and incubated with a commercial anti-SARS-CoV-2 Spike antibody (1/1000 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were incubated at 37°C in a humidified incubator with 5% CO2 and frequently tested for mycoplasma contamination using MycoAlert™ detection kit (Lonza, LT07-118).
-
bioRxiv - Immunology 2023Quote: ... Cells were cultured at 37°C with 5% CO2 and were regularly tested for mycoplasma contamination using the MycoAlert® PLUS Mycoplasma Detection Kit (Lonza, LT07-703), and authenticated by Microsynth ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Immunology 2019Quote: ... mice were reconstituted 4 hrs post-irradiation with 5 million donor bone marrow cells in 200 μl Hank’s Balanced Salt Solution (HBSS; Lonza, distributed by VWR, Lutterworth, UK), administered by intravenous injection into the tail vein ...
-
bioRxiv - Genetics 2023Quote: ... of sg1617 or sg1618 was mixed with 500 pmol (5 μM) of 3xNLS-SpCas9-SpCas9 protein and added electroporation buffer (Lonza 4D, cat# V4XP-3024) up to 25 μl in one tube ...
-
bioRxiv - Genetics 2023Quote: ... of sg1617 or sg1618 (see sequences of sgRNAs in Table S2) was mixed with 100 pmol (5 μM) of 3xNLS-SpCas9 protein and added electroporation buffer (Lonza 4D, cat# V4XP-3032) up to 5 μl in one tube ...
-
bioRxiv - Cancer Biology 2023Quote: All cell lines were cultured at 37°C and 5% CO2 and tested for mycoplasma contamination using a MycoAlert® mycoplasma detection kit (Lonza, cat: LT07-218). Only mycoplasma-negative cells were used.
-
bioRxiv - Cell Biology 2020Quote: U2OS FlpIN TRex cells with stable dox-inducible expression of MLS-EGFP-mCherry (referred to as IMLS cells) 11 were grown and maintained in a complete medium of Dulbecco’s Modified Eagle Medium (DMEM – Lonza 12-741F) supplemented with 10% v/v foetal bovine serum (FBS – Sigma Aldrich #F7524 ...
-
bioRxiv - Microbiology 2022Quote: ... 2 ml of 2% SeaPlaque™ Agarose (Lonza) in DMEM containing 2% FBS and 1% penicillin/streptomycin (P/S ...
-
bioRxiv - Microbiology 2021Quote: ... 2◻ml of 2% Seaplaque agar (Lonza) in Dulbecco’s modified Eagle medium (DMEM ...
-
bioRxiv - Microbiology 2021Quote: ... 2◻ml of 2% Seaplaque agar (Lonza) in DMEM containing 2% FBS ...
-
bioRxiv - Immunology 2020Quote: ... The cells were cultured in a humidified chamber at 37 °C under 5% CO2 and were routinely tested for mycoplasma contamination using MycoAlert plus detection kit (Lonza, Basel, Switzerland; cat. LT07-701).
-
bioRxiv - Immunology 2022Quote: ... -coated 6-well plates in X-VIVO 15 media (Lonza), supplemented with rhActivin A ...
-
bioRxiv - Biochemistry 2020Quote: ... Tissues were embedded in 6% low-melting point agarose (Lonza) for two minutes on ice ...
-
bioRxiv - Developmental Biology 2021Quote: Passage 1-6 human umbilical vein endothelial cells (HUVEC, Lonza) were cultured in 0.003% Endothelial cell growth supplement (Millipore) ...
-
bioRxiv - Immunology 2024Quote: ... and used at passage 6 (Lonza, CC-3156 & CC-4147). Primary human brain pericytes were obtained from Cell Systems (ACBRI 498) ...
-
bioRxiv - Bioengineering 2020Quote: ... HUVECs were cultured in Endothelial Growth Medium 2 (EGM-2) and NHLFs were cultured in Fibroblast Growth Medium 2 (FGM-2) (Lonza, Walkersville, MD). All cells were cultured in incubators at 37 °C and 5% CO2 ...
-
bioRxiv - Bioengineering 2021Quote: ... were purchased from Lonza and cultured in EGM-2 and FGM-2 (Lonza) supplemented with EGM-MV and FGM-2 Bullet Kit ...
-
bioRxiv - Bioengineering 2022Quote: ... Endothelial Cell Growth Medium-2 (EGM-2, Lonza, Switzerland) was used as the medium ...
-
bioRxiv - Microbiology 2020Quote: ... or 6 days in growth factor-free Keratinocyte Basal Medium (Lonza) supplemented to achieve 1.5 mM [final] CaCl2.
-
bioRxiv - Neuroscience 2021Quote: ... 6 hours post transfection cells were switched to Ultraculture medium (Lonza) and grown for another 24-48hrs ...
-
bioRxiv - Immunology 2023Quote: ... and embedded in 6% w/v low melting point agarose (Lonza) in 1x PBS ...
-
bioRxiv - Bioengineering 2022Quote: Endothelial cords were cultured in EGM-2 (EBM-2 with the addition of EGM-2 BulletKit) (Lonza). For most experiments ...
-
Cardiac pericytes are necessary for coronary vasculature integrity and cardiomyocyte differentiationbioRxiv - Physiology 2022Quote: ... were cultured in endothelial basal medium-2 (EBM-2) supplemented with EGM™-2 BulletKits™ (Lonza). Cells at passage 3 were used.
-
bioRxiv - Physiology 2020Quote: ... were cultured in endothelial basal medium-2 (EBM-2) supplemented with EGM™-2 BulletKit™ (Lonza). Cell from passage 3 to passage 6 were used ...
-
bioRxiv - Cancer Biology 2022Quote: ... PBMCs were isolated from peripheral blood from donors by Ficoll separation and cultured into X-Vivo 15 + 5% CTS Immune Cell SR (Lonza Cat# BE08-879H and Gibco Cat# A2596101) and activated with soluble anti-CD3 antibody (OKT3 ...
-
bioRxiv - Bioengineering 2020Quote: ... and 40 % EGM-2 (EBM-2 Lonza CC-3156; Clonetics) formed the basic medium ...
-
bioRxiv - Bioengineering 2022Quote: ... were obtained from Lonza and cultured in Endothelial Growth Medium-2 (EGM-2, Lonza) or EGM-2 BulletKit (Lonza) ...
-
bioRxiv - Immunology 2021Quote: ... Cells were cultured in EBM-2/EGM-2 medium (Lonza) with 12% FBS ...