Labshake search
Citations for Lonza :
351 - 400 of 414 citations for 5 tert butoxy 5 oxopentanoic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Cells were electroporated at 5 million cells/100 mL cells per cuvette using a Lonza 4-D nucleofector with pulsecode DP-148 (Lonza, VVPA-1002). Cells were co-cultured for 5 additional days with human astrocyte before transferring cells to homeostatic culture conditions (MGdM media ...
-
bioRxiv - Genomics 2023Quote: ... All cells were cultured with 5% CO2 at 37°C and verified to be free of mycoplasma using the MycoAlert Mycoplasma Detection Kit (Lonza, LT07-218). Wild type MCF7 cells were a gift from Howard Y ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells lines were maintained in a humidified 37°C incubator with 5% CO2 and routinely tested for mycoplasma contamination (Lonza #LT07-118).
-
bioRxiv - Molecular Biology 2023Quote: Induced pluripotent stem cells were transfected with a total of 5 μg target Cas9/gRNA plasmids with or without 1 μg repair templates using Human Stem Cell Nucleofector Kit (LONZA, Basel, Switzerland) and Nucleofector 2b device (LONZA ...
-
bioRxiv - Genomics 2023Quote: ... were washed twice with PBS and resuspended in a solution containing a 4.5:5 mixture of nucleofection buffer (Buffer SE, Lonza Lot #: S-09279) and supplement (Lonza ...
-
bioRxiv - Genomics 2023Quote: The AIDA Data Freeze v1 gene-cell matrix (1,058,909 cells from 503 Japan, Singaporean Chinese, Singaporean Malay, Singaporean Indian, and South Korea Asian donors and 5 distinct Lonza commercial controls), with BCR-seq and TCR-seq metadata ...
-
bioRxiv - Cell Biology 2024Quote: ... coated tissue culture polystyrene (TCPS) and maintained at 37° Celsius and 5% CO2 in endothelial growth medium (EGM-2 with bullet kit; Lonza, CC-3162) supplemented with 1% penicillin/streptomycin (Corning ...
-
bioRxiv - Cell Biology 2023Quote: ... Cell lines were cultured in a humidified incubator at 37°C and 5% CO2 and regularly tested for mycoplasma using the MycoAlert mycoplasma detection kit (Lonza, LT07-418).
-
bioRxiv - Biochemistry 2024Quote: ... All the cells were maintained in a humidified incubator with 5% CO2 at 37 °C and tested negative for mycoplasma by MycoAlert (Lonza, Morristown, NJ). Cells from passage 14-15 (P14-15 ...
-
bioRxiv - Microbiology 2024Quote: ... 5 million parasites were electroporated with 5-10ug of digested plasmid with an AMAXA Nucleofector II using X-001 in Human T-cell Nucleofector Solution (Lonza VPA-1002).
-
bioRxiv - Cancer Biology 2024Quote: ... All cells were cultured at 37 °C in 5% CO2 humidity and were tested routinely for mycoplasma using MycoAlert mycoplasma detection kit (Lonza, LT07-318) and appropriate positive control (Lonza ...
-
bioRxiv - Physiology 2020Quote: ... supplemented with non-essential amino acids (1%, 100x Lonza), sodium-pyruvate (1% ...
-
bioRxiv - Cell Biology 2021Quote: ... ascorbic acid and heparin (EGM-2 SingleQuots Supplements, Lonza). Cells were grown in T-75 flasks ...
-
bioRxiv - Immunology 2021Quote: ... 1% (v/v) non-essential amino acids (NEAA) (Lonza), 2mM L-glutamine (Lonza) ...
-
bioRxiv - Immunology 2020Quote: ... 1% (v/v) MEM non-essential amino acids (Lonza), 100 U/ml penicillin ...
-
bioRxiv - Immunology 2022Quote: ... 1% 100x non-essential amino acid (Lonza #13-144E), 100 mM sodium pyruvate (Lonza #13-115E) ...
-
bioRxiv - Genomics 2022Quote: ... 100 μM non-essential amino acids (Lonza, #BE13-114E), 100 μM 2-mercaptoethanol (Gibco ...
-
bioRxiv - Microbiology 2023Quote: ... and 1% non-essential amino acids mixture (NEAA; Lonza). Cells were harvested using trypsin/EDTA ...
-
bioRxiv - Cancer Biology 2020Quote: ... All cell lines were cultured at 37°C and 5% CO2 in DMEM (H3BE12-604F/U1, Lonza Group AG [Cultek S.L.U, Madrid, Spain]) supplemented with 10% tetracycline-free FBS (631106 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Microbiology 2020Quote: ... The final extension step was extended for 5 minutes and product size was confirmed by electrophoresis with a FlashGel™ DNA Kit (Lonza, Basel, Switzerland). PCR products were then purified with the DNA Clean & Concentrator kit ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Cells are spun at 1250 x g for 5 minutes and resuspended in 25 µl Lonza SF buffer (Lonza Cat. No. V4SC-2960) if cycloheximide selection will not be used or 200 µl of SF buffer if cycloheximide selection will be used.
-
bioRxiv - Molecular Biology 2023Quote: ... were grown in 10 cm2 dishes in a humidified environment at 37°C with 5% CO2 in DMEM/F12 medium (Lonza Ltd. Basel, Switzerland) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... were expanded in 10 cm2 dishes in a humidified environment at 37°C with 5% CO2 in DMEM/F12 medium (Lonza Ltd. Basel, Switzerland) supplemented with 12.5% fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2023Quote: ... plates were incubated at 37°C for 30 minutes in blocking buffer (PBS with 1% BSA, 5% FBS, and 1% human AB serum (Lonza, Walkersville, MD, USA), washed three times in PBS with 0.05% tween 20 and incubated with a commercial anti-SARS-CoV-2 Spike antibody (1/1000 ...
-
bioRxiv - Bioengineering 2023Quote: ... in 6-well tissue culture plates and were allowed to adhere for 5 hours before induction of serum starvation in EBM-2 (LONZA, Cat# CC-3156) for 16 hours prior to being administered media of interest ...
-
bioRxiv - Cell Biology 2023Quote: ... cultured for 48 h at 37°C with 5% CO2 in EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (Lonza, UK) with penicillin–streptomycin (100_U/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... cultured for 48 h at 37°C with 5% CO2 in EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (Lonza, UK) with penicillin–streptomycin (100_U/ml ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were incubated at 37°C in a humidified incubator with 5% CO2 and frequently tested for mycoplasma contamination using MycoAlert™ detection kit (Lonza, LT07-118).
-
bioRxiv - Cell Biology 2023Quote: ... The cells were used from passages 5-9 for the experiments and were cultured in endothelial cell growth Medium-2 (EGM™-2) Bulletkit™ (Lonza Bioscience) on pretreated tissue culture 6-well plate (VWR international) ...
-
bioRxiv - Immunology 2023Quote: ... Cells were cultured at 37°C with 5% CO2 and were regularly tested for mycoplasma contamination using the MycoAlert® PLUS Mycoplasma Detection Kit (Lonza, LT07-703), and authenticated by Microsynth ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Immunology 2019Quote: ... mice were reconstituted 4 hrs post-irradiation with 5 million donor bone marrow cells in 200 μl Hank’s Balanced Salt Solution (HBSS; Lonza, distributed by VWR, Lutterworth, UK), administered by intravenous injection into the tail vein ...
-
bioRxiv - Bioengineering 2023Quote: Cells were cultured at 37°C and 5% CO2 in cell-specific media: primary human umbilical vascular endothelial cells (HUVECs, Lonza; up to passage 6) in EGM-2 (Lonza ...
-
bioRxiv - Genetics 2023Quote: ... of sg1617 or sg1618 was mixed with 500 pmol (5 μM) of 3xNLS-SpCas9-SpCas9 protein and added electroporation buffer (Lonza 4D, cat# V4XP-3024) up to 25 μl in one tube ...
-
bioRxiv - Genetics 2023Quote: ... of sg1617 or sg1618 (see sequences of sgRNAs in Table S2) was mixed with 100 pmol (5 μM) of 3xNLS-SpCas9 protein and added electroporation buffer (Lonza 4D, cat# V4XP-3032) up to 5 μl in one tube ...
-
bioRxiv - Cancer Biology 2023Quote: All cell lines were cultured at 37°C and 5% CO2 and tested for mycoplasma contamination using a MycoAlert® mycoplasma detection kit (Lonza, cat: LT07-218). Only mycoplasma-negative cells were used.
-
bioRxiv - Cancer Biology 2022Quote: ... supplemented with ascorbic acid (75 μg/mL, Lonza, #CC-4398), human recombinant insulin (20 μg/mL ...
-
bioRxiv - Immunology 2020Quote: ... The cells were cultured in a humidified chamber at 37 °C under 5% CO2 and were routinely tested for mycoplasma contamination using MycoAlert plus detection kit (Lonza, Basel, Switzerland; cat. LT07-701).
-
bioRxiv - Microbiology 2022Quote: ... 100 µg/ml streptomycin and 1 % non-essential amino acids (Lonza) in a humidified incubator at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... 100 µg/ml streptomycin and 1 % non-essential amino acids (Lonza) in a humidified incubator at 37°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... PBMCs were isolated from peripheral blood from donors by Ficoll separation and cultured into X-Vivo 15 + 5% CTS Immune Cell SR (Lonza Cat# BE08-879H and Gibco Cat# A2596101) and activated with soluble anti-CD3 antibody (OKT3 ...
-
bioRxiv - Biochemistry 2019Quote: ... MEM-Eagle non-essential amino acids (Biological Industries) and MycoZap Prophylactic (Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) 25 mM (Lonza, 17-737F), gentamicin 25 μg/ml (Lonza ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1% non-essential amino acids and 10% fetal bovine serum (Lonza, NJ, USA). The media for ER+ cell lines were further supplemented with insulin (0.1 µg/ml) ...
-
bioRxiv - Biochemistry 2023Quote: Amino acid starvation treatment was carried out by incubating cells in HBSS buffer (Lonza) with 10% dialyzed FBS (Sigma Aldrich) ...
-
bioRxiv - Bioengineering 2019Quote: ... and gel purified using Seakem GTG agarose (for nucleic acid recovery) (Lonza, cat no. 50070), agarose dissolving buffer (ABD ...
-
bioRxiv - Microbiology 2020Quote: ... Gibco) with addition of non-essential amino acids (100X NEAA, Biowhittaker Lonza, cat. no. BE13-114E). H2L2 antibodies were purified from hybridoma culture supernatants using Protein-G affinity chromatography ...
-
bioRxiv - Cancer Biology 2023Quote: ... were separated on a PA-TBE gel and stained with GelStarTM Nucleic Acid Gel Stain (Lonza, 50535).
-
bioRxiv - Microbiology 2022Quote: ... and stained with 10 × SYBR Green I (SYBR® Green I Nucleic Acid Stain; Lonza, Rockland, ME, USA) in 1×TAE buffer for 3 min ...