Labshake search
Citations for Lonza :
1 - 50 of 708 citations for 3 hydroxy 20 oxopregn 5 en 21 yl acetate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: BHK-21 cells (clone BSRT7/5) constitutively expressing the T7 RNA polymerase (21) were grown in Dulbeco Modified Essential Medium (Lonza) supplemented with 10% fetal calf serum (FCS) ...
-
Synthetic lethal targeting of TET2-mutant hematopoietic stem and progenitor cells by XPO1 inhibitorsbioRxiv - Cancer Biology 2022Quote: ... or either of two different gRNAs targeting exon 3 coding sequences of human TET2 (TET2-gRNA #1: 5’-TGGAGAAAGACGTAACTTC-3’ and TET2-gRNA #2: 5’-TCTGCCCTGAGGTATGCGAT-3’) were transfected with Nucleofector (Lonza). After transduction ...
-
bioRxiv - Biophysics 2021Quote: ... The WT and mutant genes were then amplified from these expression plasmids using the PCR primers 5’-GCGCTAGCAGCACCCATATGCCTGAG-3’and 5’-ACGAAGCTTTCAGTGGTGGTGGTGGT-3’and subcloned into the pMaxCloning vector (Lonza, VDC-1040) via NheI and BamHI sites to generate the pMax_WT_NEIL1 and pMax_Mutant_NEIL1 expression plasmids that were utilized throughout this analysis.
-
bioRxiv - Microbiology 2020Quote: ... 5 μg of RNA was electroporated into 5×106 BHK-21 cells using the Amaxa nucleofector 2b (program A-031) and Nucleofection T solution kit (Lonza). Transfected BHK-21 cells were mixed with HuH7 or Vero cells in a 1:1 ratio and plated for harvesting supernatants ...
-
bioRxiv - Microbiology 2023Quote: BHK-21 cells (clone BSRT7/5) constitutively expressing the T7 RNA polymerase47 were grown in Dulbeco Modified Essential Medium (Lonza) supplemented with 10% fetal calf serum (FCS) ...
-
bioRxiv - Bioengineering 2024Quote: ... cells were transferred into a cuvette for subsequent nucleofection with the 4D-Nucleofector (Lonza, program EN-158). After electroporation ...
-
bioRxiv - Cell Biology 2024Quote: ... prepared in tris-acetate (40 mM)/EDTA (10 mM) buffer and 5 μl of GelStar Nucleic Acid Stain 10,000 x (Lonza, 50535). 20 μl per sample resulting from PCR were mixed with Blue/Orange loading buffer loading dye 6x (PROMEGA ...
-
bioRxiv - Bioengineering 2023Quote: ... Adipose-derived stem cells (Passage 3-5) (Lonza, Walkersville, MD, USA) were cultured in a basal medium consisting of DMEM/F12 ...
-
bioRxiv - Bioengineering 2021Quote: ... were used between passages 3-5 for paxillin experiments and culture medium was changed every 2-3 days (Lonza FBM Basal Medium supplemented with 2 v/v% fetal bovine serum (FBS) ...
-
bioRxiv - Bioengineering 2020Quote: ... passage 3-5 AFC were dissociated and resuspended in EGM-2 (Lonza) at 4×105 cells/mL ...
-
bioRxiv - Bioengineering 2024Quote: ... 21 μg/ml Bovine Pituitary Extract (BPE; Lonza, CC-4009), and 4 μM forskolin (Calbiochem ...
-
bioRxiv - Bioengineering 2023Quote: ... 21 μg/ml Bovine Pituitary Extract (BPE; Lonza, CC-4009), and 4 μM forskolin (Calbiochem ...
-
bioRxiv - Microbiology 2022Quote: ... EMEM (ATCC; MRC-5 and Calu-3 cells) (Lonza; Tb-1 Lu cells) or MEM (Gibco ...
-
bioRxiv - Molecular Biology 2024Quote: ... at 21°C in Insect Xpress Protein-free Insect Cell Medium (Lonza) supplemented with GlutaMAX (GIBCO ...
-
bioRxiv - Bioengineering 2022Quote: ... 20 μL of T cells were resuspended in P3 buffer at 5 × 107 cells/mL (Lonza) and added to the electroporation mixture ...
-
bioRxiv - Biophysics 2021Quote: Commercially available primary human umbilical vein endothelial cells (HUVECs) (pooled, passages 3-5, Lonza, Basel, Switzerland) were grown in EGM-2 medium (Lonza ...
-
bioRxiv - Cancer Biology 2020Quote: ... Between 1×10^3 – 5×10^4 cells were re-suspended in 20μl Buffer P3 (Lonza) per reaction and quickly added to the Eppendorf tube containing the CRISPR/Cas9 gRNA RNP complex ...
-
bioRxiv - Genetics 2024Quote: ... Approximately 2.5×105 CD34+ HSPCs were mixed with gRNA:Cas9 complexes and 3 µg ssDNA donor template (20 μL) in nucleofector strip format (Lonza). Electroporation was performed in Unit X ...
-
bioRxiv - Cell Biology 2022Quote: ... Electroporation with the CA-137 program was performed 3-5 min after this addition (Lonza Group AG). Following this ...
-
bioRxiv - Immunology 2024Quote: ... 3 x 106 freshly isolated monocytes or BMDMs were resuspended in 20 µl of P3 primary cell nucleofection buffer (Lonza). Cells were then added to the Cas9-RNP complexes ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.3×106 live cells were resuspended with the RNP complex and 20 µL of P3 Primary Cell Nucleofector Solution (Lonza), following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... and CD59 (deficient HAP-1 cells) (21) were cultured in Iscove’s Modified Dulbecco’s Medium (IMDM; Lonza) supplemented with 10% (v/v ...
-
bioRxiv - Genomics 2020Quote: ... and 5×104 cells were resuspended in 20 μL SF electroporation buffer prepared with SF supplement (Lonza, Basel, Switzerland). 3 μL RNP complex solution was mixed with the cells and the cells were nucleofected using program DJ-110 on a 4D-Nucleofector (Lonza ...
-
bioRxiv - Cell Biology 2023Quote: ... RNP were formed by mixing 5 to 9 μgr base editor protein with 1.5 μgr of sgRNA in 20 μL of P3 buffer (Lonza, Amaxa P3 Primary Cell 4D-Nucleofector Kit ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA directed against Dsg1 (Integrated DNA Technologies) with a targeting sequence 5′-CCATTAGAGAGTGGCAATAGGATGA-3′ using Amaxa Nucleofector System (Lonza) for electroporation of cells according to manufacturer’s instructions.
-
bioRxiv - Neuroscience 2024Quote: ... and 300μM single stranded oligodeoxynucleotides (ssODN: 5’gggtccagggtggctgtcactcat ccttttttctggctaccaaaggtgcagataattaaGaagaagctggatcttagcaacgtccagccaagtgtggctcaaaggataatatc aaacacgtcc 3’) and the P3 Primary Cell 4D reaction mix (Lonza). We screened a minimum of 96 clones for genetic editing ...
-
bioRxiv - Immunology 2020Quote: ... Transfection of primary T cells with Cas9 RNP complexes and TCRβα HDR templates was performed 3-4 days following activation using the 4D-Nucleofector and a 20 uL format P3 Primary Cell kit (Lonza, V4XP-3032). Briefly ...
-
bioRxiv - Bioengineering 2024Quote: ... at a ratio of 3:1 bead/cell and 20 IU of IL-2 (Preprotech, 200-02) in X-Vivo media (Lonza, 02-053Q) supplemented with 5% human serum and Pen/Strep ...
-
bioRxiv - Microbiology 2023Quote: ... BHK-21 Clone 13 (ATCC number CCL-10) were cultured in Glasgow Minimum essential medium (GMEM, Lonza) supplemented with 10% (v/v ...
-
bioRxiv - Cell Biology 2024Quote: ... serum-starved RPE1 cells where trypsinized and 0.5×106 of the cells were resuspended in 20 μl of the P3 Primary Cell 4D-Nucleofector Kit buffer (Lonza). The cell suspension was then nucleoporated with reporter plasmids with DNA lesions and undamaged control plasmids ...
-
bioRxiv - Genetics 2020Quote: ... ∼1×106 cells were transfected with pairs of 5 µg gRNA plasmid and 4 µg ssODN (Supplementary Table 3) using AmaxaTM Human CD34 Cell NucleofectorTM Kit (Lonza) in the 2B-NucleofectorTM on the U-08 setting ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: PDLSCs mineralization on the scaffolds after 21 days of osteogenic differentiation was assessed using OsteoImage Mineralization Assay (Lonza). This assay’s staining reagent binds specifically to the hydroxyapatite portion of bonelike nodules deposited by cells ...
-
bioRxiv - Cell Biology 2020Quote: ... 20% FCS (Lonza), 2 mM L-Glutamine ...
-
bioRxiv - Bioengineering 2022Quote: ... GM-3TM Lymphocyte Growth Medium-3 (LGM-3™) (Lonza), Opti-MEM Serum-Free medium (Thermofisher) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5 µg of PX459 gRNA vector (5’-GACTCCAGTCTTTCTAGAAGA-3’) were nucleofected with the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-100) using program A-30 in the XRep ...
-
bioRxiv - Microbiology 2021Quote: ... the transfected cells were co-cultured with BHK-21 cells (ATCC CCL-10) transfected with VSV-G using the SE cell Line 4D-Nucleofector X Kit L (Lonza) in DMEM without glutamine (Life Technologies) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 µg RNA was electroporated into BHK-21 cells using an Amaxa nucleofector 2b (program A-031) and Nucleofection T solution kit (Lonza). Transfected BHK-21 cells were mixed in a 1:1 ratio with cells susceptible to CoV infection ...
-
bioRxiv - Biophysics 2022Quote: ... The transfected cells were then co-cultured with BHK-21 cells (ATCC CCL-10) transfected with VSV-G using the SE cell Line 4D-Nucleofector X Kit L (Lonza) and cultured until virus-mediated CPE was observed ...
-
bioRxiv - Cell Biology 2024Quote: ... with a density of 1.5 x106 using a 1:70 inoculation from the V1 stock for 92 hours at 21°C in Insect Xpress Protein-free Insect Cell Medium (Lonza) supplemented with GlutaMAX (GIBCO ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Microbiology 2021Quote: ... HEPES (20 mM, Lonza), sodium pyruvate (1 mM ...
-
bioRxiv - Cancer Biology 2020Quote: ... supplemented with 20% FBS (Lonza) and 1% penicillin–streptomycin ...
-
bioRxiv - Genomics 2020Quote: ... donors (passage 2-3; Lonza) were continuously passaged to replicative exhaustion in complete Endopan-2 supplemented with 2% FBS under 5% CO2 ...
-
bioRxiv - Systems Biology 2020Quote: ... and 20 mg/L gentamicin (Lonza), and were differentiated into DCs by application of 800 U/mL GM-CSF (Miltenyi Biotec ...
-
bioRxiv - Immunology 2021Quote: ... 20 mM Hepes (all from Lonza), 1 mg/ml Collagenase D (Sigma) ...
-
bioRxiv - Physiology 2023Quote: ... and a 20% FBS BulletKit (Lonza) as described previously 24.
-
bioRxiv - Cancer Biology 2023Quote: ... in 20-µL Nucleocuvette strips (Lonza). Cells were nucleofected using the program CM-125 or CM-130 set to P3 buffer ...
-
bioRxiv - Immunology 2021Quote: Commercially available human primary PTs from 6 donors (3 males and 3 females, Lonza Walkersville Inc) were expanded at passage 4 ...