Labshake search
Citations for Lonza :
1 - 50 of 567 citations for 3 O tert Butyldimethylsilyl 24 ethyl 24 phenylsulfonyl cholest 5 ene 3 ol d7 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: Larvae were anesthetized with 0.02% ethyl 3-aminobenzoate methanesulfonate salt (Tricane, (E10521, Ethyl 3-aminobenzoate methanesulfonate) and mounted in 1% low melting point agarose (50100, Lonza) in a 60 mm x 15 mm petri dish ...
-
PSGL-1 inhibits HIV-1 infection by restricting actin dynamics and sequestering HIV envelope proteinsbioRxiv - Microbiology 2020Quote: ... 1×106 activated CD4+T cells were stimulated by IFN-γ for 24 h before being transfected with 3 siRNAs following Amaxa Nucleofector following the manufacturer’s protocols (Lonza). Two days post transfection ...
-
bioRxiv - Neuroscience 2021Quote: ... program A-24 (Lonza). 1.0μg pSIN4-EF2-O2S and pSIN4-EF2-N2L were used for each electroporation ...
-
Synthetic lethal targeting of TET2-mutant hematopoietic stem and progenitor cells by XPO1 inhibitorsbioRxiv - Cancer Biology 2022Quote: ... or either of two different gRNAs targeting exon 3 coding sequences of human TET2 (TET2-gRNA #1: 5’-TGGAGAAAGACGTAACTTC-3’ and TET2-gRNA #2: 5’-TCTGCCCTGAGGTATGCGAT-3’) were transfected with Nucleofector (Lonza). After transduction ...
-
bioRxiv - Molecular Biology 2024Quote: ... for TC-NER UDS siRNA transfected primary XP186LV fibroblasts (XP-C patient cells) were seeded on 24 mm coverslips and serum-deprived for at least 24 hours in Ham’s F10 (Lonza) containing 0.25% FCS to arrest cells in G0 ...
-
bioRxiv - Biophysics 2021Quote: ... The WT and mutant genes were then amplified from these expression plasmids using the PCR primers 5’-GCGCTAGCAGCACCCATATGCCTGAG-3’and 5’-ACGAAGCTTTCAGTGGTGGTGGTGGT-3’and subcloned into the pMaxCloning vector (Lonza, VDC-1040) via NheI and BamHI sites to generate the pMax_WT_NEIL1 and pMax_Mutant_NEIL1 expression plasmids that were utilized throughout this analysis.
-
bioRxiv - Neuroscience 2022Quote: ... The 24-well Dipping Electrode Array (Lonza Bioscience) was carefully placed onto the 24-well culture plate avoiding air bubbles ...
-
bioRxiv - Bioengineering 2022Quote: ... 24-well RAFT™ absorbers (Lonza, Slough, UK) were used to plastic compress them for 15 min ...
-
bioRxiv - Bioengineering 2021Quote: ... were used between passages 3-5 for paxillin experiments and culture medium was changed every 2-3 days (Lonza FBM Basal Medium supplemented with 2 v/v% fetal bovine serum (FBS) ...
-
bioRxiv - Bioengineering 2023Quote: ... Adipose-derived stem cells (Passage 3-5) (Lonza, Walkersville, MD, USA) were cultured in a basal medium consisting of DMEM/F12 ...
-
bioRxiv - Immunology 2022Quote: ... [70] for 24 hours in reduced medium (basal EBM2 (Lonza) supplemented with Gentamicin ...
-
bioRxiv - Biochemistry 2023Quote: ... 24 h prior to transfection with an Amaxa nucleofector (Lonza) using programme Z-001 ...
-
bioRxiv - Bioengineering 2020Quote: ... passage 3-5 AFC were dissociated and resuspended in EGM-2 (Lonza) at 4×105 cells/mL ...
-
bioRxiv - Immunology 2022Quote: ... 24 mM Sodium Succinate) using Amaxa™ 4D-Nucleofector™(Lonza). Electroporated B cells were culture in 200ul primary B cell medium for 6 days.
-
bioRxiv - Systems Biology 2024Quote: ... electroporated with sgRNAs and Cas9 protein (Lonza Nucleofector, program A-24), and replated into 24 well plates ...
-
bioRxiv - Bioengineering 2022Quote: ... GM-3TM Lymphocyte Growth Medium-3 (LGM-3™) (Lonza), Opti-MEM Serum-Free medium (Thermofisher) ...
-
bioRxiv - Microbiology 2022Quote: ... EMEM (ATCC; MRC-5 and Calu-3 cells) (Lonza; Tb-1 Lu cells) or MEM (Gibco ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 24 h later transfected with 4 μg of pMaxGFP plasmid (Lonza) using Fugene HD transfection reagent (Promega ...
-
bioRxiv - Bioengineering 2024Quote: ... Samples were added to the 24 μL reaction cuvettes (Lonza, Basel, Switzerland) and were nucleofected using the EH-100 program (Lonza Amaxa 4D Nucleofector ...
-
bioRxiv - Genomics 2020Quote: ... donors (passage 2-3; Lonza) were continuously passaged to replicative exhaustion in complete Endopan-2 supplemented with 2% FBS under 5% CO2 ...
-
bioRxiv - Pathology 2023Quote: ... for 24 hours in serum and supplement-free growth medium (EGM, Lonza, CC-3162). Following the incubation ...
-
bioRxiv - Biophysics 2021Quote: Commercially available primary human umbilical vein endothelial cells (HUVECs) (pooled, passages 3-5, Lonza, Basel, Switzerland) were grown in EGM-2 medium (Lonza ...
-
bioRxiv - Cancer Biology 2020Quote: ... Between 1×10^3 – 5×10^4 cells were re-suspended in 20μl Buffer P3 (Lonza) per reaction and quickly added to the Eppendorf tube containing the CRISPR/Cas9 gRNA RNP complex ...
-
bioRxiv - Genomics 2021Quote: ... were plated on type I collagen-coated 24-well plates in plating medium (MP100, Lonza) and maintained in hepatocyte growth medium (HCM ...
-
bioRxiv - Immunology 2021Quote: Commercially available human primary PTs from 6 donors (3 males and 3 females, Lonza Walkersville Inc) were expanded at passage 4 ...
-
bioRxiv - Biophysics 2021Quote: ... HUVECs (Lonza, expanded to passage 3) were transduced with GFP tagged VE-cadherin (65 ...
-
bioRxiv - Cell Biology 2022Quote: ... Electroporation with the CA-137 program was performed 3-5 min after this addition (Lonza Group AG). Following this ...
-
bioRxiv - Molecular Biology 2021Quote: ... at a confluence of 80-90% were incubated for 24 hours with EBM-2 medium (Lonza) containing 1% FBS (Gibco ...
-
bioRxiv - Bioengineering 2023Quote: ... according to manufacturer’s instructions in a 24-well plate containing X-VIVO 15 media (Lonza, 04418Q) supplemented with 5% FBS (Sigma-Aldrich) ...
-
bioRxiv - Bioengineering 2022Quote: ... and 3% FBS (all from Lonza Biosciences), termed astrocyte medium ...
-
bioRxiv - Molecular Biology 2020Quote: ... Days 16-24 media contained recombinant Oncostatin M (20ng/ml, Thermo) in HCM media lacking EGF (Lonza).
-
bioRxiv - Immunology 2022Quote: ... 24 and 48 well-plates in EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (LONZA) supplemented with GlutaMax (ThermoFisher ...
-
bioRxiv - Bioengineering 2024Quote: ... The HMEC-1 cells (passage number 24 or 26) were detached with trypsin/EDTA (CC-5012, Lonza), centrifuged at 220 g ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Dry powder (2-3 mg) was loaded into an HPMC size 3 capsule (VCaps® Plus, Lonza, Morristown, NJ). The capsule was placed in a Plastiape high resistance RS00 DPI that was then attached to a Next Generation Impactor (NGI ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA directed against Dsg1 (Integrated DNA Technologies) with a targeting sequence 5′-CCATTAGAGAGTGGCAATAGGATGA-3′ using Amaxa Nucleofector System (Lonza) for electroporation of cells according to manufacturer’s instructions.
-
bioRxiv - Neuroscience 2024Quote: ... and 300μM single stranded oligodeoxynucleotides (ssODN: 5’gggtccagggtggctgtcactcat ccttttttctggctaccaaaggtgcagataattaaGaagaagctggatcttagcaacgtccagccaagtgtggctcaaaggataatatc aaacacgtcc 3’) and the P3 Primary Cell 4D reaction mix (Lonza). We screened a minimum of 96 clones for genetic editing ...
-
bioRxiv - Neuroscience 2021Quote: ... coated coverslips in a 24-well plate in 1ml Endothelial Growth Media-2 Bullet Kit (EGM-2; Lonza; Endothelial basal media-2 with 2% Fetal Bovine Serum (FBS) ...
-
bioRxiv - Immunology 2023Quote: ... 24-well plate) at a concentration of 75,000 cells per well in Smooth muscle growth medium (SmGM) (Lonza) and left to adhere and spread for 90 minutes ...
-
bioRxiv - Immunology 2022Quote: ... supplemented with fetal calf serum (FCS, 3%, Lonza) and HEPES (1.8%) ...
-
bioRxiv - Immunology 2022Quote: ... supplemented with fetal calf serum (FCS, 3%, Lonza) and HEPES (1.8% ...
-
bioRxiv - Microbiology 2023Quote: ... and 3 ml of ACK lysis buffer (Lonza) was added to the cells and incubated for 5 min ...
-
bioRxiv - Neuroscience 2024Quote: ... were nucleofected into 3 million cells by LONZA 4D-Nucleofector using program CB-150 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3% MetaPhorTM Agarose gels (Cat. No. 50181, Lonza) were used ...
-
bioRxiv - Genetics 2020Quote: ... ∼1×106 cells were transfected with pairs of 5 µg gRNA plasmid and 4 µg ssODN (Supplementary Table 3) using AmaxaTM Human CD34 Cell NucleofectorTM Kit (Lonza) in the 2B-NucleofectorTM on the U-08 setting ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: MG-63 cells (1000 per well, 24-well plate) were seeded into 0.4% low melting point agarose (Lonza, 50101) on top of a 1% agarose layer ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Vero cells were plated at 2.5 x 105 cell/well in 24-well plates in Essential-modified Eagle Medium (EMEM, Lonza) supplemented with 10% fetal calf serum (FCS ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA transfected primary XP186LV (XP-C patient cells) were serum-deprived for at least 24 hours in Ham’s F10 (Lonza) containing 0.5% FCS and antibiotics to arrest cells in G0 ...
-
bioRxiv - Cell Biology 2022Quote: ... 300 pmol of HDR oligonucleotide was electroporated into one million HEK293 Flp-In T-Rex cells along with 2.5 μg each of pSpCas9(BB)-2A-Puro and BiP gRNA plasmid (Amaxa kit R, program A-24; Lonza). Immediately after electroporation ...
-
bioRxiv - Cell Biology 2022Quote: ... HLFs were seeded in four wells of a 24-well plate in antibiotic free medium containing 2 % (Lonza, PromoCell) or 10 % (DZL ...