Labshake search
Citations for Lonza :
1 - 50 of 680 citations for 3 Bromo 4 8 dichloro 5 methoxyquinoline since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... Between 1×10^3 – 5×10^4 cells were re-suspended in 20μl Buffer P3 (Lonza) per reaction and quickly added to the Eppendorf tube containing the CRISPR/Cas9 gRNA RNP complex ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were seeded on the fibronectin-coated Petri dish (TPP) and kept in the incubator (37 °C and 5% CO2) for 4-8 h in the EGM-2 (Lonza) containing 2% FBS ...
-
bioRxiv - Biophysics 2021Quote: ... in passages 4-8 were cultured in EGM2-MV medium (Lonza) at 37°C in a humidified atmosphere of 95% air and 5% CO2 ...
-
bioRxiv - Cell Biology 2022Quote: ... in passages 4-8 were cultured in EGM2-MV medium (Lonza) at 37°C in a humidified atmosphere of 95% air and 5% CO2 ...
-
bioRxiv - Cell Biology 2024Quote: ... in passages 4-8 were cultured in EGM2-MV medium (Lonza).
-
bioRxiv - Genetics 2020Quote: ... ∼1×106 cells were transfected with pairs of 5 µg gRNA plasmid and 4 µg ssODN (Supplementary Table 3) using AmaxaTM Human CD34 Cell NucleofectorTM Kit (Lonza) in the 2B-NucleofectorTM on the U-08 setting ...
-
Synthetic lethal targeting of TET2-mutant hematopoietic stem and progenitor cells by XPO1 inhibitorsbioRxiv - Cancer Biology 2022Quote: ... or either of two different gRNAs targeting exon 3 coding sequences of human TET2 (TET2-gRNA #1: 5’-TGGAGAAAGACGTAACTTC-3’ and TET2-gRNA #2: 5’-TCTGCCCTGAGGTATGCGAT-3’) were transfected with Nucleofector (Lonza). After transduction ...
-
bioRxiv - Bioengineering 2023Quote: ... in passages 5-8 were cultured at 37°C and 5% CO2 in EGM2 cell medium (Lonza). Cells were detached from the adhering surface using TrypLE (Life Technologies ...
-
bioRxiv - Biophysics 2021Quote: ... The WT and mutant genes were then amplified from these expression plasmids using the PCR primers 5’-GCGCTAGCAGCACCCATATGCCTGAG-3’and 5’-ACGAAGCTTTCAGTGGTGGTGGTGGT-3’and subcloned into the pMaxCloning vector (Lonza, VDC-1040) via NheI and BamHI sites to generate the pMax_WT_NEIL1 and pMax_Mutant_NEIL1 expression plasmids that were utilized throughout this analysis.
-
bioRxiv - Bioengineering 2023Quote: ... Adipose-derived stem cells (Passage 3-5) (Lonza, Walkersville, MD, USA) were cultured in a basal medium consisting of DMEM/F12 ...
-
bioRxiv - Cell Biology 2022Quote: ... followed by 3-4 days of culture in SmGM complete media (Lonza) supplemented with 1% penicillin-streptomycin to expand cell numbers ...
-
bioRxiv - Cancer Biology 2023Quote: ... Every 3-4 weeks the medium was additionally supplemented with MycoZap (Lonza) to prevent mycoplasma contamination ...
-
bioRxiv - Neuroscience 2023Quote: ... split into 3-4 wells each and cultured in DMEM-F12 (Lonza) containing 10% fetal bovine serum (FBS ...
-
bioRxiv - Neuroscience 2024Quote: ... split into 3-4 wells each and cultured in DMEM-F12 (Lonza) containing 10% fetal bovine serum (FBS ...
-
bioRxiv - Bioengineering 2021Quote: ... were used between passages 3-5 for paxillin experiments and culture medium was changed every 2-3 days (Lonza FBM Basal Medium supplemented with 2 v/v% fetal bovine serum (FBS) ...
-
bioRxiv - Bioengineering 2020Quote: ... passage 3-5 AFC were dissociated and resuspended in EGM-2 (Lonza) at 4×105 cells/mL ...
-
bioRxiv - Cell Biology 2023Quote: Drosophila ovaries (5-8 pairs per sample) were dissected into room temperature Grace’s insect medium (Lonza). Ovaries were fixed for 10 min using 4% paraformaldehyde diluted in Grace’s medium ...
-
bioRxiv - Cell Biology 2024Quote: ... were used in passages 4-8 and expanded in flasks in Fibroblast Basal Medium (Lonza, #CC-3131) with FGM2-Fibroblast Growth Medium BulletKit (Lonza ...
-
bioRxiv - Neuroscience 2023Quote: ... iPS cells were passaged every 3-4 days with Accutase (Lonza, Basel, Switzerland) and seeded on new plates with density 1:5 – 1:10 in iPS medium with ROCK inhibitor Y-27632 (Sigma-Aldrich) ...
-
bioRxiv - Bioengineering 2023Quote: ... using antibiotic-free endothelial media and were lifted for seeding at passage 5-8 (Lonza, Walkersville, MD). After lifting ...
-
bioRxiv - Microbiology 2022Quote: ... EMEM (ATCC; MRC-5 and Calu-3 cells) (Lonza; Tb-1 Lu cells) or MEM (Gibco ...
-
bioRxiv - Bioengineering 2024Quote: ... human liver endothelial cells (LECs) (Lonza HLECP1; 4-5×106 cells/ml) were first loaded in the basal channel followed by seeding of human Huh7 hepatocytes (Sekisui JCRB0403-P ...
-
bioRxiv - Microbiology 2022Quote: ... pH 8 (Lonza), stained with SyberGreen (Sigma Aldrich) ...
-
bioRxiv - Cell Biology 2020Quote: ... and 8 × 105 cells were electroporated using 5 mg of total DNA (Ratio 1:1) and the Amaxa Nucleofector kit (Lonza) as described (Ran et al. ...
-
bioRxiv - Biophysics 2021Quote: Commercially available primary human umbilical vein endothelial cells (HUVECs) (pooled, passages 3-5, Lonza, Basel, Switzerland) were grown in EGM-2 medium (Lonza ...
-
bioRxiv - Cell Biology 2022Quote: ... Electroporation with the CA-137 program was performed 3-5 min after this addition (Lonza Group AG). Following this ...
-
bioRxiv - Molecular Biology 2021Quote: Inguinal white adipose tissue from 3-4 WT-C57Bl/6 male mice was collected and placed in Dulbecco’s modified eagle’s medium (DMEM; Lonza) supplemented with 1% Penicillin/Streptomycin (PS ...
-
bioRxiv - Developmental Biology 2020Quote: ... about 8 × 105 iPSCs were transfected with 5 μg of plasmids with Lonza Human Stem Cell Nucleofector Kit 1 (Lonza, VPH-5012) on a Nucleofector 2b device (Lonza ...
-
bioRxiv - Neuroscience 2021Quote: ... Tissues were washed 3-4 times over 1 hour in PBS (calcium- and magnesium-free; Lonza BioWhittaker #17-517Q) containing 0.1% Triton X-100 (PBT ...
-
bioRxiv - Cancer Biology 2023Quote: ... Regular testing for mycoplasma contamination was conducted every 3-4 weeks using the MycoAlert PLUS mycoplasma detection kit (Lonza).
-
bioRxiv - Cell Biology 2021Quote: ... Passaging of iPSCs was carried out every 4-5 days using Versene (EDTA 0.02%) (Lonza, BE17–771E) solution for 3–5⍰minutes at 37⍰°C ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA directed against Dsg1 (Integrated DNA Technologies) with a targeting sequence 5′-CCATTAGAGAGTGGCAATAGGATGA-3′ using Amaxa Nucleofector System (Lonza) for electroporation of cells according to manufacturer’s instructions.
-
bioRxiv - Neuroscience 2024Quote: ... and 300μM single stranded oligodeoxynucleotides (ssODN: 5’gggtccagggtggctgtcactcat ccttttttctggctaccaaaggtgcagataattaaGaagaagctggatcttagcaacgtccagccaagtgtggctcaaaggataatatc aaacacgtcc 3’) and the P3 Primary Cell 4D reaction mix (Lonza). We screened a minimum of 96 clones for genetic editing ...
-
bioRxiv - Molecular Biology 2020Quote: ... at Day 3-4 of phase I culture were electroporated using P3 Primary Cell 4D NucleofectorTM X Kit (from Lonza) with program DZ100 (Bak et al. ...
-
bioRxiv - Immunology 2021Quote: ... 2.106 T cells were resuspended in 20 µl of nucleofection solution with 3 µl or 4 µl RNP and transferred to Nucleofection cuvette strips (4D-Nucleofector X kit S; Lonza). Murine T cells were electroporated using the DN110 program of 4D nucleofector (4D-Nucleofector Core Unit ...
-
bioRxiv - Cell Biology 2021Quote: ... were isolated from healthy donors (n=3) as described[4] and seeded on 6 cm dishes within BEGM media (Lonza) before transduction with lentivirus (empty vector (Origene ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were passaged 1:10 every 3-4 days by trypsinisation and were regularly screened for mycoplasma contamination (Mycoalert, Lonza).
-
bioRxiv - Cell Biology 2024Quote: PC-3 cells (1 × 106 cells) were transfected with 2 μg of mGFP-GPI cDNA using a 4-D nucleofector (LONZA) and cultured in two 150-mm dishes until reaching approximately 100% confluence (2 × 107 cells) ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Human primary hepatic stellate cells from donors 3 and 4 were purchased as isolated hepatic stellate cells from Lonza (cat# HUCLS). Donor information is listed below.
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were harvested with trypsin, pelleted (500 g, 5 min, 4°C) and resuspended in PBS (pH 7.4) containing EDTA (Lonza) and 10% fetal bovine serum ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were harvested with trypsin, pelleted (500 g, 5 min, 4°C) and resuspended in PBS (pH 7.4) containing EDTA (Lonza) and 10% fetal bovine serum ...
-
bioRxiv - Immunology 2020Quote: ... Transfection of primary T cells with Cas9 RNP complexes and TCRβα HDR templates was performed 3-4 days following activation using the 4D-Nucleofector and a 20 uL format P3 Primary Cell kit (Lonza, V4XP-3032). Briefly ...
-
bioRxiv - Pathology 2024Quote: Primary human lung fibroblasts from either IPF patients (n=4) or donors with no history of lung fibrosis (n=5) were purchased from Lonza at P2 (Supplementary Table 6) ...
-
bioRxiv - Microbiology 2021Quote: An 8% SeaPlaque GTG Agarose (Lonza, Basel, Switzerland) solution in Ultra Pure Water (Genesee Scientific ...
-
bioRxiv - Bioengineering 2022Quote: ... GM-3TM Lymphocyte Growth Medium-3 (LGM-3™) (Lonza), Opti-MEM Serum-Free medium (Thermofisher) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5 µg of PX459 gRNA vector (5’-GACTCCAGTCTTTCTAGAAGA-3’) were nucleofected with the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-100) using program A-30 in the XRep ...
-
bioRxiv - Genomics 2020Quote: ... Human umbilical vein endothelial cells were isolated from umbilical cords of healthy donors after cesarean sections (HUVECS; n = 4; RWTH Aachen) (55) or obtained from Lonza (n = 3, Basel, Switzerland) (8) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...