Labshake search
Citations for Lonza :
1 - 50 of 652 citations for 3' Chloro 3 3 chloro 5 fluorophenyl 4' fluoropropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Synthetic lethal targeting of TET2-mutant hematopoietic stem and progenitor cells by XPO1 inhibitorsbioRxiv - Cancer Biology 2022Quote: ... or either of two different gRNAs targeting exon 3 coding sequences of human TET2 (TET2-gRNA #1: 5’-TGGAGAAAGACGTAACTTC-3’ and TET2-gRNA #2: 5’-TCTGCCCTGAGGTATGCGAT-3’) were transfected with Nucleofector (Lonza). After transduction ...
-
bioRxiv - Biophysics 2021Quote: ... The WT and mutant genes were then amplified from these expression plasmids using the PCR primers 5’-GCGCTAGCAGCACCCATATGCCTGAG-3’and 5’-ACGAAGCTTTCAGTGGTGGTGGTGGT-3’and subcloned into the pMaxCloning vector (Lonza, VDC-1040) via NheI and BamHI sites to generate the pMax_WT_NEIL1 and pMax_Mutant_NEIL1 expression plasmids that were utilized throughout this analysis.
-
bioRxiv - Bioengineering 2022Quote: ... GM-3TM Lymphocyte Growth Medium-3 (LGM-3™) (Lonza), Opti-MEM Serum-Free medium (Thermofisher) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Between 1×10^3 – 5×10^4 cells were re-suspended in 20μl Buffer P3 (Lonza) per reaction and quickly added to the Eppendorf tube containing the CRISPR/Cas9 gRNA RNP complex ...
-
bioRxiv - Bioengineering 2021Quote: ... were used between passages 3-5 for paxillin experiments and culture medium was changed every 2-3 days (Lonza FBM Basal Medium supplemented with 2 v/v% fetal bovine serum (FBS) ...
-
bioRxiv - Bioengineering 2023Quote: ... Adipose-derived stem cells (Passage 3-5) (Lonza, Walkersville, MD, USA) were cultured in a basal medium consisting of DMEM/F12 ...
-
bioRxiv - Cell Biology 2022Quote: ... followed by 3-4 days of culture in SmGM complete media (Lonza) supplemented with 1% penicillin-streptomycin to expand cell numbers ...
-
bioRxiv - Cancer Biology 2023Quote: ... Every 3-4 weeks the medium was additionally supplemented with MycoZap (Lonza) to prevent mycoplasma contamination ...
-
bioRxiv - Neuroscience 2023Quote: ... split into 3-4 wells each and cultured in DMEM-F12 (Lonza) containing 10% fetal bovine serum (FBS ...
-
bioRxiv - Neuroscience 2024Quote: ... split into 3-4 wells each and cultured in DMEM-F12 (Lonza) containing 10% fetal bovine serum (FBS ...
-
bioRxiv - Genomics 2020Quote: ... donors (passage 2-3; Lonza) were continuously passaged to replicative exhaustion in complete Endopan-2 supplemented with 2% FBS under 5% CO2 ...
-
bioRxiv - Bioengineering 2020Quote: ... passage 3-5 AFC were dissociated and resuspended in EGM-2 (Lonza) at 4×105 cells/mL ...
-
bioRxiv - Genetics 2020Quote: ... ∼1×106 cells were transfected with pairs of 5 µg gRNA plasmid and 4 µg ssODN (Supplementary Table 3) using AmaxaTM Human CD34 Cell NucleofectorTM Kit (Lonza) in the 2B-NucleofectorTM on the U-08 setting ...
-
bioRxiv - Neuroscience 2023Quote: ... iPS cells were passaged every 3-4 days with Accutase (Lonza, Basel, Switzerland) and seeded on new plates with density 1:5 – 1:10 in iPS medium with ROCK inhibitor Y-27632 (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2022Quote: ... EMEM (ATCC; MRC-5 and Calu-3 cells) (Lonza; Tb-1 Lu cells) or MEM (Gibco ...
-
bioRxiv - Immunology 2021Quote: Commercially available human primary PTs from 6 donors (3 males and 3 females, Lonza Walkersville Inc) were expanded at passage 4 ...
-
bioRxiv - Biophysics 2021Quote: ... HUVECs (Lonza, expanded to passage 3) were transduced with GFP tagged VE-cadherin (65 ...
-
bioRxiv - Bioengineering 2022Quote: ... and 3% FBS (all from Lonza Biosciences), termed astrocyte medium ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Dry powder (2-3 mg) was loaded into an HPMC size 3 capsule (VCaps® Plus, Lonza, Morristown, NJ). The capsule was placed in a Plastiape high resistance RS00 DPI that was then attached to a Next Generation Impactor (NGI ...
-
bioRxiv - Neuroscience 2023Quote: Larvae were anesthetized with 0.02% ethyl 3-aminobenzoate methanesulfonate salt (Tricane, (E10521, Ethyl 3-aminobenzoate methanesulfonate) and mounted in 1% low melting point agarose (50100, Lonza) in a 60 mm x 15 mm petri dish ...
-
bioRxiv - Immunology 2022Quote: ... supplemented with fetal calf serum (FCS, 3%, Lonza) and HEPES (1.8%) ...
-
bioRxiv - Immunology 2022Quote: ... supplemented with fetal calf serum (FCS, 3%, Lonza) and HEPES (1.8% ...
-
bioRxiv - Microbiology 2023Quote: ... and 3 ml of ACK lysis buffer (Lonza) was added to the cells and incubated for 5 min ...
-
bioRxiv - Neuroscience 2024Quote: ... were nucleofected into 3 million cells by LONZA 4D-Nucleofector using program CB-150 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3% MetaPhorTM Agarose gels (Cat. No. 50181, Lonza) were used ...
-
bioRxiv - Biophysics 2021Quote: Commercially available primary human umbilical vein endothelial cells (HUVECs) (pooled, passages 3-5, Lonza, Basel, Switzerland) were grown in EGM-2 medium (Lonza ...
-
bioRxiv - Cell Biology 2022Quote: ... Electroporation with the CA-137 program was performed 3-5 min after this addition (Lonza Group AG). Following this ...
-
bioRxiv - Neuroscience 2021Quote: ... embedded in 3% agarose (Lonza, # 50004, Rockland, ME, USA) and coronally sectioned (Leica VT1000S vibratome ...
-
bioRxiv - Molecular Biology 2021Quote: Inguinal white adipose tissue from 3-4 WT-C57Bl/6 male mice was collected and placed in Dulbecco’s modified eagle’s medium (DMEM; Lonza) supplemented with 1% Penicillin/Streptomycin (PS ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR products were resolved on 3% Metaphor agarose gel (Lonza), and DNA fragments of sizes approximately 150-200 nt were isolated from the gel using Qiagen’s Gel Extraction Kit (Figure 1D) ...
-
bioRxiv - Bioengineering 2020Quote: ... Cells were maintained in FGM-3 Medium (CC-4526, Lonza) and passaged at 80% confluence.
-
bioRxiv - Microbiology 2022Quote: Sterile molten top NA (3 mL; 0.2 % SeaPlaque Agarose, Lonza) supplemented with CaCl2 and MgCl2 (both at 5 mM ...
-
bioRxiv - Neuroscience 2022Quote: ... brains were embedded in 3% agarose (SeaKem LE Agarose, Lonza). 150 μm thick vibratome sections (VT1000S vibratome ...
-
bioRxiv - Neuroscience 2022Quote: ... brains were embedded in 3% agarose (SeaKem LE Agarose, Lonza) and vibratome-sectioned (VT1000S vibratome ...
-
bioRxiv - Systems Biology 2024Quote: ... and finally resuspended in a cold SSC cocktail (3× Lonza AccuGENE SSC ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... CF patient# 3 (#28388-0000450918, Lonza, male, 25 years-old) and four non-CF donors with no pathology reported ...
-
bioRxiv - Neuroscience 2021Quote: ... Tissues were washed 3-4 times over 1 hour in PBS (calcium- and magnesium-free; Lonza BioWhittaker #17-517Q) containing 0.1% Triton X-100 (PBT ...
-
bioRxiv - Cancer Biology 2023Quote: ... Regular testing for mycoplasma contamination was conducted every 3-4 weeks using the MycoAlert PLUS mycoplasma detection kit (Lonza).
-
bioRxiv - Cell Biology 2021Quote: ... siRNA directed against Dsg1 (Integrated DNA Technologies) with a targeting sequence 5′-CCATTAGAGAGTGGCAATAGGATGA-3′ using Amaxa Nucleofector System (Lonza) for electroporation of cells according to manufacturer’s instructions.
-
bioRxiv - Neuroscience 2024Quote: ... and 300μM single stranded oligodeoxynucleotides (ssODN: 5’gggtccagggtggctgtcactcat ccttttttctggctaccaaaggtgcagataattaaGaagaagctggatcttagcaacgtccagccaagtgtggctcaaaggataatatc aaacacgtcc 3’) and the P3 Primary Cell 4D reaction mix (Lonza). We screened a minimum of 96 clones for genetic editing ...
-
bioRxiv - Molecular Biology 2020Quote: ... at Day 3-4 of phase I culture were electroporated using P3 Primary Cell 4D NucleofectorTM X Kit (from Lonza) with program DZ100 (Bak et al. ...
-
bioRxiv - Immunology 2021Quote: ... 2.106 T cells were resuspended in 20 µl of nucleofection solution with 3 µl or 4 µl RNP and transferred to Nucleofection cuvette strips (4D-Nucleofector X kit S; Lonza). Murine T cells were electroporated using the DN110 program of 4D nucleofector (4D-Nucleofector Core Unit ...
-
bioRxiv - Cell Biology 2021Quote: ... were isolated from healthy donors (n=3) as described[4] and seeded on 6 cm dishes within BEGM media (Lonza) before transduction with lentivirus (empty vector (Origene ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were passaged 1:10 every 3-4 days by trypsinisation and were regularly screened for mycoplasma contamination (Mycoalert, Lonza).
-
bioRxiv - Cell Biology 2024Quote: PC-3 cells (1 × 106 cells) were transfected with 2 μg of mGFP-GPI cDNA using a 4-D nucleofector (LONZA) and cultured in two 150-mm dishes until reaching approximately 100% confluence (2 × 107 cells) ...
-
bioRxiv - Immunology 2021Quote: Calu-3 epithelial lung cancer cells were cultured in DMEM (Lonza) supplemented with 10% heat inactivated fetal calf serum ...
-
bioRxiv - Cell Biology 2022Quote: ... the PBS was removed and 3 mL of SkBM-2 (Lonza) media was added to each chamber ...
-
bioRxiv - Microbiology 2022Quote: ... 3 ml of lung digestion buffer containing HBSS (Lonza, BE10-508F), 5% FBS ...
-
bioRxiv - Microbiology 2022Quote: ... a 3 ml of DMEM containing 0.5% SeaKem ME agarose (Lonza), 5% (v/v ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR products were size-selected using 3% NuSieve agarose gels (Lonza) followed by gel extraction using QIAEX II reagents (Qiagen) ...