Labshake search
Citations for Lonza :
401 - 436 of 436 citations for IL 5 Mouse since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... All cells were cultured at 37 °C in 5% CO2 humidity and were tested routinely for mycoplasma using MycoAlert mycoplasma detection kit (Lonza, LT07-318) and appropriate positive control (Lonza ...
-
bioRxiv - Biochemistry 2024Quote: ... All the cells were maintained in a humidified incubator with 5% CO2 at 37 °C and tested negative for mycoplasma by MycoAlert (Lonza, Morristown, NJ). Cells from passage 14-15 (P14-15 ...
-
bioRxiv - Developmental Biology 2020Quote: ... and nucleofected with BioID constructs using an Amaxa Nucleofector II and the Mouse Neural Stem Cell Nucleofector Kit (Lonza; VPG-1004) according the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: BMDMs (1 × 106 cells) were transfected with siRNA (250 pmol) and Amaxa Mouse Macrophage Nucleofector Kit (Lonza, catalog number VPA-1009) using a Lonza Nucleofector 2b device (Lonza ...
-
bioRxiv - Developmental Biology 2019Quote: ... 4 μg of the donor ssDNA and 3 μg of a puromycin resistance plasmid (pCAG-puroR) using the Mouse ES Cell Nucleofector™ Kit (Lonza) following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... complex and mix of 1:1 ratio WT/mutant donor single-stranded oligodeoxynucleotides carrying PAM mutation by electroporation using Mouse Embryonic Stem Cell Nucleofector™ Kit from Lonza. sgRNA and donor single-stranded oligodeoxynucleotide sequences can be found in supplementary table 5 ...
-
bioRxiv - Cancer Biology 2020Quote: ... All cell lines were cultured at 37°C and 5% CO2 in DMEM (H3BE12-604F/U1, Lonza Group AG [Cultek S.L.U, Madrid, Spain]) supplemented with 10% tetracycline-free FBS (631106 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Microbiology 2020Quote: ... The final extension step was extended for 5 minutes and product size was confirmed by electrophoresis with a FlashGel™ DNA Kit (Lonza, Basel, Switzerland). PCR products were then purified with the DNA Clean & Concentrator kit ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Cells are spun at 1250 x g for 5 minutes and resuspended in 25 µl Lonza SF buffer (Lonza Cat. No. V4SC-2960) if cycloheximide selection will not be used or 200 µl of SF buffer if cycloheximide selection will be used.
-
bioRxiv - Molecular Biology 2023Quote: ... were grown in 10 cm2 dishes in a humidified environment at 37°C with 5% CO2 in DMEM/F12 medium (Lonza Ltd. Basel, Switzerland) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... were expanded in 10 cm2 dishes in a humidified environment at 37°C with 5% CO2 in DMEM/F12 medium (Lonza Ltd. Basel, Switzerland) supplemented with 12.5% fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2023Quote: ... plates were incubated at 37°C for 30 minutes in blocking buffer (PBS with 1% BSA, 5% FBS, and 1% human AB serum (Lonza, Walkersville, MD, USA), washed three times in PBS with 0.05% tween 20 and incubated with a commercial anti-SARS-CoV-2 Spike antibody (1/1000 ...
-
bioRxiv - Bioengineering 2023Quote: ... in 6-well tissue culture plates and were allowed to adhere for 5 hours before induction of serum starvation in EBM-2 (LONZA, Cat# CC-3156) for 16 hours prior to being administered media of interest ...
-
bioRxiv - Cell Biology 2023Quote: ... cultured for 48 h at 37°C with 5% CO2 in EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (Lonza, UK) with penicillin–streptomycin (100_U/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... cultured for 48 h at 37°C with 5% CO2 in EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (Lonza, UK) with penicillin–streptomycin (100_U/ml ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were incubated at 37°C in a humidified incubator with 5% CO2 and frequently tested for mycoplasma contamination using MycoAlert™ detection kit (Lonza, LT07-118).
-
bioRxiv - Cell Biology 2023Quote: ... The cells were used from passages 5-9 for the experiments and were cultured in endothelial cell growth Medium-2 (EGM™-2) Bulletkit™ (Lonza Bioscience) on pretreated tissue culture 6-well plate (VWR international) ...
-
bioRxiv - Immunology 2023Quote: ... Cells were cultured at 37°C with 5% CO2 and were regularly tested for mycoplasma contamination using the MycoAlert® PLUS Mycoplasma Detection Kit (Lonza, LT07-703), and authenticated by Microsynth ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Immunology 2021Quote: ... 1.5×106 cells multiplied by the number of mice to be injected were transfected with the pIL-10 vector (1×106 cells/1.5 μg pIL-10 DNA per cuvette) using the Mouse T Cell Nucleofector Kit (Lonza, No: VPA-1006) with Nucleofector II Device (program X-100) ...
-
bioRxiv - Evolutionary Biology 2021Quote: DNA delivery into human/mouse ESCs for CRISPR/Cas9 targeting were performed using a Nucleofector 2b Device (Lonza, Cat. No. BioAAB-1001). Human Stem Cell Nucleofector Kit 1 (Cat ...
-
bioRxiv - Developmental Biology 2021Quote: ... 4 μg of the donor ssDNA and 3 μg of a puromycin resistance plasmid (pCAG-puroR) using the Mouse ES Cell Nucleofector™ Kit (Lonza, Switzerland) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... Point mutations were introduced into CJ7 WT using CRISPR RNP transfected into cells with the Amaxa mouse ES kit (Lonza VPH-1001). 1×106 cells were transfected with the RNP containing two separate guide RNAs a single stranded donor oligo and a linearized puromycin resistance gene ...
-
bioRxiv - Immunology 2019Quote: ... conjugated to FITC or GFP siRNA (300 nM) conjugated to FITC two days prior to adoptive T cell therapy using the Mouse T cell Nucleofector™ Kit (Lonza Bioscience) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2019Quote: ... mice were reconstituted 4 hrs post-irradiation with 5 million donor bone marrow cells in 200 μl Hank’s Balanced Salt Solution (HBSS; Lonza, distributed by VWR, Lutterworth, UK), administered by intravenous injection into the tail vein ...
-
bioRxiv - Genetics 2023Quote: ... of sg1617 or sg1618 was mixed with 500 pmol (5 μM) of 3xNLS-SpCas9-SpCas9 protein and added electroporation buffer (Lonza 4D, cat# V4XP-3024) up to 25 μl in one tube ...
-
bioRxiv - Genetics 2023Quote: ... of sg1617 or sg1618 (see sequences of sgRNAs in Table S2) was mixed with 100 pmol (5 μM) of 3xNLS-SpCas9 protein and added electroporation buffer (Lonza 4D, cat# V4XP-3032) up to 5 μl in one tube ...
-
bioRxiv - Bioengineering 2023Quote: Cells were cultured at 37°C and 5% CO2 in cell-specific media: primary human umbilical vascular endothelial cells (HUVECs, Lonza; up to passage 6) in EGM-2 (Lonza ...
-
bioRxiv - Cancer Biology 2023Quote: All cell lines were cultured at 37°C and 5% CO2 and tested for mycoplasma contamination using a MycoAlert® mycoplasma detection kit (Lonza, cat: LT07-218). Only mycoplasma-negative cells were used.
-
bioRxiv - Genomics 2021Quote: ... E14 cells were transfected with this plasmid library using a Nucleofector™ 2b device using the Mouse ES Cell Nucleofector Kit (Lonza, VAPH-1001). For each of the three biological replicates ...
-
bioRxiv - Immunology 2020Quote: ... The cells were cultured in a humidified chamber at 37 °C under 5% CO2 and were routinely tested for mycoplasma contamination using MycoAlert plus detection kit (Lonza, Basel, Switzerland; cat. LT07-701).
-
bioRxiv - Neuroscience 2019Quote: ... the dissociated neurons were centrifuged down to remove the supernatant and resuspended in 80 to 100 μl of Amaxa electroporation buffer for mouse neurons (Lonza Cologne GmbH; Cologne, Germany) with mixtures of siRNA (0.2 nmol per transfection ...
-
bioRxiv - Cancer Biology 2023Quote: NPE cells were transfected by electroporation using a Lonza® Nucleofector 2b device and the Lonza® Mouse Neural Stem Cell Nucleofector Kit (Lonza; #VPG-1004) according to the manufacturer’s instructions using the T-030 pulse code.
-
bioRxiv - Cancer Biology 2022Quote: ... PBMCs were isolated from peripheral blood from donors by Ficoll separation and cultured into X-Vivo 15 + 5% CTS Immune Cell SR (Lonza Cat# BE08-879H and Gibco Cat# A2596101) and activated with soluble anti-CD3 antibody (OKT3 ...
-
bioRxiv - Genomics 2021Quote: ... were thawed onto a 60 mm tissue-treated culture dish seeded with irradiated mouse embryonic fibroblasts (MEFs) as feeders in DMEM high glucose base medium supplemented with 15% fetal bovine serum (FBS, Lonza cat. no. 14-501F lot no. 0000217266), 1X Pen/Strep ...