Labshake search
Citations for Lonza :
401 - 450 of 2520 citations for Estrone 3 Glucuronide E1G ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... and the Human Monocyte Nucleofector Kit (Lonza) as previously described (Schnoor et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... supplemented with EGM-2 SingleQuot Kit (Lonza). HPAEC were cultured in multi-well cell culture plates and flasks coated with 0.1 % gelatin ...
-
bioRxiv - Immunology 2022Quote: ... Vienna) were electroporated (Nucleofector Kit; Lonza, Switzerland) with two Cas9/sgRNA vectors encoding GFP as a marker and the targeting DNA template containing the miRNA cluster flanked by loxP sites ...
-
bioRxiv - Genomics 2019Quote: ... and Basic NucleofectorTM Kit (Lonza, VPI-1002), and the electroporation program was U-023 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... or using an Amaxa nucleofector kit (Lonza) for transfection of plasmids into THP-1 and RAW264.7 cells ...
-
bioRxiv - Microbiology 2021Quote: ... with additives (MEGM kit, Lonza CC-3150) with 100 ng/mL cholera toxin (Sigma).
-
bioRxiv - Cancer Biology 2021Quote: ... supplemented with EBM-2 bullet kit (Lonza). Human pulmonary EC line ST1.6R48 was provided by Ronald E ...
-
bioRxiv - Immunology 2021Quote: ... Amaxa nucleofector kit C (Lonza, Basel, Switzerland) designed for nucleofection of T2 cells was used ...
-
bioRxiv - Neuroscience 2022Quote: ... and Human CD34+ Cell Nucleofector Kit (Lonza) using a Nucleofector 2b Device (Lonza) ...
-
bioRxiv - Neuroscience 2023Quote: ... Human Stem Cell kit (VPH-5012, Lonza) and the B-016 programme on the Amaxa Nucleofector II B device (Amaxa Biosystems) ...
-
bioRxiv - Cancer Biology 2022Quote: ... the AMAXA-V kit (VCA-1003, Lonza) was used according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... and Amaxa Kit V (Lonza #VCA-1003) Program T-023.
-
bioRxiv - Cell Biology 2023Quote: ... and SingleQuot Kit CC-4127 REGM (Lonza). Subconfluent primary cells were expanded for and frozen for experiments.
-
bioRxiv - Cell Biology 2023Quote: ... or the Amaxa nuclefector kit V (Lonza) and Amaxa Nucleofector II (Lonza ...
-
bioRxiv - Cell Biology 2024Quote: ... using the MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Cancer Biology 2024Quote: ... using a mycoplasma detection kit (MycoAlert, Lonza). For bulk lysate-based analyses (RNA sequencing and western blot) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... A high resistance Plastiape® RS00 inhaler (Plastiape S.p.A, Osnago, Italy) containing size #3 HPMC capsules (V-Caps® Plus, Lonza, Morristown, NJ) and 1-3 mg of powder was attached to a USP induction port by a molded silicon adapter ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... were seeded onto 96-well plates at a density of 3×104 cells per well in 100 μL cell culture media that consisted of DMEM (Lonza, Basel, Switzerland), 1% penicillin–streptomycin (Lonza ...
-
bioRxiv - Immunology 2021Quote: ... using SF Cell line 4D-Nucleofector® X Kit L or X Kit S (Lonza, V4XC-2024, V4XC-2032) with the program CQ-104 ...
-
bioRxiv - Immunology 2022Quote: ... 1% penicillin-streptomycin and 1% Ultra-glutamine (both from Lonza) RPMI 1640 media ...
-
bioRxiv - Neuroscience 2019Quote: ... 1% NEAA (Lonza), 1% N2 supplement (Thermo Scientific) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1% Ultraglutamine (Lonza)) in each well ...
-
bioRxiv - Genetics 2022Quote: ... 1% glutamine (Lonza) and 1% penicillin-streptomycin (Sigma) ...
-
bioRxiv - Immunology 2021Quote: ... hematopoietic progenitors were harvested and the hemogenic endothelium left behind in the 12-well plate was cultured in X-VIVO15 (Lonza, Basel, Switzerland) supplemented with β-mercaptoethanol (Gibco) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Single cells from digested mammary glands were resuspended and plated on Collagen I-coated plates (50μg/ml) in stem cell-enriching medium MEBM (Lonza Cat. #CC-3151), supplemented with 2% B27 (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... All isolated Tregs were activated by plate bound anti-CD3 and anti-CD28 antibodies and cultured with X-VIVO 20 media (LONZA #04-448Q) supplemented by 1X Pen/Strep ...
-
bioRxiv - Cancer Biology 2021Quote: ... Collected cells were counted at a density of 100,000 per well and seeded on matrigel pre-coated 6-well plates supplied with KBM-Gold keratinocyte growth medium (Lonza, Cat# 00192060) at 37°C in a humidified chamber with 5% carbon dioxide ...
-
bioRxiv - Cancer Biology 2021Quote: ... Primary uveal melanoma cells were equally divided onto two wells of a fibronectin-covered 6-well tissue culture plate and grown in 5% CO2 in MDMF medium which consists of HAM’s F12 (Lonza, Walkersville MD, USA) supplemented with 1 mg/mL BSA (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... The cells were cultivated together with mixed glial cells plated on the bottom of 12-well plates for 7 days in EBM-2 medium (Lonza, Basel, Switzerland) containing 15% PDS ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... droplets in 6 well plates and treated with retinoic acid for 4 days followed by hepatocyte growth media (Hepatocyte Culture Medium BulletKit (Lonza, CC-3198) supplemented with 10 ng/mL hepatocyte growth factor (PeproTech ...
-
bioRxiv - Cell Biology 2024Quote: ... monocytes were cultured in 24-well plates (Labclinics, Barcelona, Spain) at a concentration of 106 cells/ml in either X-VIVO 15 media (Lonza, Basel, Switzerland) or RPMI 1640 media (ThermoFisher Scientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... EBs are transferred to a 6-well plate with 20 EBs/well and placed in macrophage precursor medium (X-vivo15 (Lonza, BE02-060Q), 100 ng/mL M-CSF (Peprotech ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Five milligrams of niclosamide inhalation powder was loaded into size #3 hydroxypropyl methylcellulose capsules (Vcaps® plus, Capsugel®, Lonza, Morristown, NJ, USA). The aerodynamic properties of the powder were evaluated using a Next Generation Impactor (NGI ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Cancer Biology 2021Quote: ... They were routinely tested for mycoplasma using a luminescence-based mycoplasma detection kit (MycoAlert Mycoplasma Detection kit, Lonza #: LT07-318).
-
bioRxiv - Cancer Biology 2023Quote: ... Cell lines were authenticated by short tandem repeat profiling using the service of the ATCC (FTA sample collection kit) and routinely checked for mycoplasma using the MycoAlert mycoplasma detection kit (Lonza). Ingenol-3-angelate (I3A ...
-
bioRxiv - Cancer Biology 2024Quote: ... resuspended in 20 μL of P3 nucleofection/solution plus cas9/sgRNA mixture (P3 Primary Cell 4D-NucleofectorTM X Kit S) for primary T cells or SF Cell Line 4D-NucleofectorTM X Kit S (Lonza) for MM cell lines ...
-
bioRxiv - Immunology 2020Quote: ... and using Nucleofector electroporation kit (VPI-1001, Lonza) for exECs (Program M-003 ...
-
bioRxiv - Molecular Biology 2021Quote: ... supplemented with EGM-2 Bullet kit (Lonza, 3162) at 37°C and 5% CO2 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... using the MycoAlert PLUS assay kit from Lonza, and were authenticated by short tandem repeat profiling ...
-
bioRxiv - Molecular Biology 2020Quote: ... the Human T Cell Nucleofector Kit (Lonza, Switzerland) was used according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... Bronchial Epithelial Growth Medium BEGM bullet kit (Lonza), Bronchial Air Liquid Interface B-ALI media (Lonza) ...
-
bioRxiv - Bioengineering 2021Quote: ... using the Human CD34+ cell nucleofector kit (Lonza) with program U-008 ...
-
bioRxiv - Cell Biology 2021Quote: ... and Lonza nucleofection kit V (Lonza, VCA-1003) following manufacturer’s guidelines ...
-
bioRxiv - Cancer Biology 2022Quote: ... and applying the MycoAlert™ detection kit (Lonza) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2022Quote: ... melanoma cell lines were purchased from Sigma Aldrich and periodically tested with MycoAlertTM kit (Lonza, Switzerland). B16-10 were grown in RPMI-1640 medium (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2020Quote: ... using the mouse ES Cell nucleofector kit (Lonza) and Amaxa Nucleofector II device (Lonza ...
-
bioRxiv - Cancer Biology 2022Quote: ... using Amaxa 4D-Nucleofector X kit L (Lonza).
-
bioRxiv - Genomics 2021Quote: ... The Amaxa Cell Line Nucleofector Kit V (Lonza) was used according to the manufacturer’s protocol to transfect constructs and dsRNA into 5-10 million BG3 or S2 cells using programs T30 or G30 ...