Labshake search
Citations for Lonza :
401 - 450 of 571 citations for 6 Methyl 5 propyl 4 1H pyrimidinone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... Cell pellets were carefully enrobed in an equal volume of molten 5% low-melting temperature agarose (Lonza, Rockland, ME) and allowed to cool ...
-
bioRxiv - Cell Biology 2023Quote: ... RNP were formed by mixing 5 to 9 μgr base editor protein with 1.5 μgr of sgRNA in 20 μL of P3 buffer (Lonza, Amaxa P3 Primary Cell 4D-Nucleofector Kit ...
-
bioRxiv - Microbiology 2024Quote: ... Cell pellets were carefully enrobed in an equal volume of molten 5% low-melting temperature agarose (Lonza, Rockland, ME) and allowed to cool ...
-
bioRxiv - Cancer Biology 2024Quote: ... Red blood cell lysis was performed for 5 min at room temperature in ACK lysing buffer (Lonza, #10-548E). For flow cytometry ...
-
bioRxiv - Microbiology 2022Quote: ... Cell pellets were carefully enrobed in an equal volume of molten 5% low-melting temperature agarose (Lonza, Rockland, ME) and allowed to cool ...
-
bioRxiv - Biochemistry 2024Quote: Human HeLa cells (ATCC) were grown at 37°C in 5% CO2 using Dulbecco’s Modified Eagle Medium (Lonza, USA) supplemented with 10% FBS superior (Biochrom ...
-
bioRxiv - Genomics 2023Quote: ... Cells were grown at 37°C and 5% CO2 and passed with Hepes buffered saline solution (Lonza, CC-5024) and 0.25% Trypsin-EDTA (Gibco ...
-
bioRxiv - Bioengineering 2023Quote: Primary human alveolar epithelial cells (HPAECs, CellBiologics) were cultured at 37°C and 5% CO2 with SABM medium (Lonza), SAGM supplements (Lonza) ...
-
bioRxiv - Biochemistry 2023Quote: Plasma cholesterol was depleted by treating HEK293 cells with 5 mM MβCD for 30 min in Pro293A-CDM (Lonza); this short period of MβCD treatment was deemed sufficient to removed 50% of endogenous cholesterol from cells (34) ...
-
bioRxiv - Immunology 2022Quote: ... were coated overnight at 4°C with 25μL of SEC fractions 1 to 5 diluted 1:2 with PBS (Cat. No. LZBE17-512F, Lonza). Wells were washed with 0.05% Tween-20 (Cat ...
-
bioRxiv - Microbiology 2022Quote: ... and the well was gently washed once with 5 mL of phosphate buffered saline (PBS, Lonza, Rockland, ME, USA) to remove un-adherent floating bacteria ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were pelleted at 1000 rpm for 5 min and resuspended in 100 μL nucleofector solution (Lonza, #VPB-1002) before adding 2.5 μg of plasmid ...
-
bioRxiv - Developmental Biology 2023Quote: ... were cultured at 37°C and 5% CO2 in EGMTM Endothelial Cell Growth Medium with BulletKitTM (Lonza CC-3124) and 1x antibiotic-antimycotic (Gibco ...
-
bioRxiv - Immunology 2023Quote: ... Cas9-gRNA ribonucleoproteins were assembled as described previously53 and nucleofected into 5×106 monocytes in 100μL nucleofection buffer (Human Monocyte Nucleofection Kit, Lonza) using a Nucleofector 2b (Lonza ...
-
bioRxiv - Neuroscience 2024Quote: ... and 300μM single stranded oligodeoxynucleotides (ssODN: 5’gggtccagggtggctgtcactcat ccttttttctggctaccaaaggtgcagataattaaGaagaagctggatcttagcaacgtccagccaagtgtggctcaaaggataatatc aaacacgtcc 3’) and the P3 Primary Cell 4D reaction mix (Lonza). We screened a minimum of 96 clones for genetic editing ...
-
bioRxiv - Biochemistry 2024Quote: Human lung carcinoma A549 cells (ATCC) were grown at 37°C in 5% CO2 using Dulbecco’s Modified Eagle Medium (Lonza) supplemented with 10% FBS superior (Biochrom ...
-
bioRxiv - Cell Biology 2024Quote: Primary human mammary epithelial cells (HMECs) were cultured at 37°C with 5% CO2 in MEBM basal medium (Lonza) supplemented with MEGM SingleQuots (Lonza ...
-
bioRxiv - Immunology 2020Quote: ... 106 cells per condition were nucleofected with 4 µg of DNA using the Amaxa Nucleofector II (Lonza, Kit R; program R-024). Nucleofected cells were allowed to recover for 24-48 hours before sorting for GFP positivity and lack of CD56 expression.
-
bioRxiv - Immunology 2020Quote: ... Transfection of primary T cells with Cas9 RNP complexes and TCRβα HDR templates was performed 3-4 days following activation using the 4D-Nucleofector and a 20 uL format P3 Primary Cell kit (Lonza, V4XP-3032). Briefly ...
-
bioRxiv - Immunology 2022Quote: ... puromycin containing medium were changed and every 4 days cells were fed EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (LONZA) supplemented with GlutaMax (ThermoFisher ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... droplets in 6 well plates and treated with retinoic acid for 4 days followed by hepatocyte growth media (Hepatocyte Culture Medium BulletKit (Lonza, CC-3198) supplemented with 10 ng/mL hepatocyte growth factor (PeproTech ...
-
bioRxiv - Bioengineering 2024Quote: ... RNP’s and DNA were electroporated (EP) into T-cells in 16 well EP cuvettes on a 4-D Nucleofector X unit (Cat # V4XP-3032, Lonza, Walkersville, VA) using pulse code EH-115 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were maintained at 37°C and 5 % CO2 in a humidified atmosphere and routinely tested to be mycoplasma negative (MycoAlert Mycoplasma Detection Kit, Lonza). Cells were cultured no longer than 15 passages before experimental use.
-
bioRxiv - Neuroscience 2021Quote: ... Cells were resuspended and transfected by combining 5×105 viable cells with 400 ng plasmid DNA and nucleofection solution in a 25 µL electroporation cuvette (Lonza). Electroporation of GCaMP mutants was performed according to the manufacturer’s protocol.
-
bioRxiv - Microbiology 2020Quote: ... 3 x 107 bloodstream form cells were harvested by centrifugation and transfected with 5-10 μg of linearized plasmid DNA using an Amaxa Nucleofector II (Lonza) with program X-001 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were transfected by combining 5×105 viable cells with 400 ng plasmid DNA and nucleofection solution electroporation cuvettes (Lonza). Electroporation was performed according to the manufacturer instructions ...
-
bioRxiv - Immunology 2021Quote: ... of four genetically independent donors were grown as monolayers in 100% humidity and 5% CO2 at 37 °C in serum-free defined growth media (BEGM, Lonza). NHBEs (passage 3 ...
-
bioRxiv - Genomics 2020Quote: ... 5 million cells were transfected with 5 μg of DNA FAIRE-STARR library plasmid using the Amaxa Nucleofector kit V (Lonza). For each condition ...
-
bioRxiv - Bioengineering 2020Quote: ... were cultured under standard incubation conditions at 37 °C and 5% CO2 in endothelial growth media (EGM BulletKit CC-3124, Lonza). For all imaging experiments ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were maintained in culture at 37°C with 5% CO2 and regularly screened to ensure the absence of mycoplasma contamination (MycoAlert, Lonza).
-
bioRxiv - Cancer Biology 2020Quote: ... All cell lines were maintained in 37 °C and 5% CO2 incubators and routinely tested negative for mycoplasma contamination using the MycoAlert Kit (Lonza).
-
bioRxiv - Cancer Biology 2020Quote: ... The cells were grown in a humidified incubator at 37°C with 5% CO2 and routinely tested for mycoplasma infection (MycoAlert, Lonza). The identity of the cell line was confirmed by DNA fingerprinting (Laragen ...
-
bioRxiv - Cancer Biology 2020Quote: ... were cultured according to manufactureŕs instructions in a humidified incubator with 5% CO2 at 37 °C and routinely checked and tested negative for mycoplasma contamination using MycoAlertPlusTM Mycoplasma Detection Kit (Lonza) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... The RNP complex and 1.5 μg of a linearized homology-directed repair template plasmid were transfected into 2×105 – 5×105 nocodazole-arrested mitotic HeLa A12 cells using a Nucleofector and the associated Cell Line Kit R (Lonza) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... was combined with 15 pmol total synthetic sgRNA (5 pmol each sgRNA) (Synthego) to form ribonucleoproteins (RNPs) in 20uL total volume with SE Buffer (Lonza). The RNP assembly reaction was mixed by pipetting up and down and incubated at room temperature for 10 minutes.
-
bioRxiv - Microbiology 2021Quote: ... duncani parasites were maintained in A+ hRBCs (American Red Cross) at 5% hematocrit in HL-1 base medium (Lonza 344017) supplemented with 20% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were maintained at 37 °C and 5% CO2 and were frequently tested for mycoplasma contamination using MycoAlert Mycoplasma Detection Kit (Lonza). Cells were plated on 25-mm diameter coverslips and transfected using Fugene6 transfection reagent (Roche ...
-
bioRxiv - Systems Biology 2020Quote: ... 24 hours activated DC and T cells were incubated in 96 well plates at a DC/T ratio 1:5 in Xvivo15 medium (Lonza). After 6 days ...
-
bioRxiv - Microbiology 2020Quote: ... All cells used in this study were cultured in a humidified incubator at 37°C with 5% CO2 and routinely tested and certified as mycoplasma-free using the MycoAlert kit (Lonza). STR analysis (Idexx ...
-
bioRxiv - Cancer Biology 2020Quote: ... All cells were grown at 37°C in a humidified atmosphere with 5% CO2 and tested for lack of mycoplasma contamination (MycoAlert Mycoplasma Detection Kit, Lonza) prior to experiments (initiated within the initial 1-4 passages).
-
bioRxiv - Cell Biology 2021Quote: ... Cell lines were cultured in a humidified incubator at 37°C and 5% CO2 in Iscove’s modified Dulbecco’s medium (IMDM; Lonza, Basel, Switzerland) with 2 mM Ultraglutamine (Lonza) ...
-
bioRxiv - Cancer Biology 2022Quote: Cell lines were cultured according to standard aseptic mammalian tissue culture protocols in 5% CO2 at 37 °C with regular testing for mycoplasma contamination using the MycoAlertTM Mycoplasma Detection Kit (Lonza). HCT116 ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 x 106 NSCs were mixed with 5 µg of corresponding DNA with the Amaxa P4 Primary Cell 4D-Nucleofector X Kit S (Lonza) and pulse was delivered using the CA137 programme in a 4D-Nucleofector X Unit (Lonza) ...
-
bioRxiv - Developmental Biology 2022Quote: Primary HDLECs were isolated from neonatal human foreskins as described previously (74) and cultured from passages 5 – 7 on fibronectin-coated plates with EGM-2 MV growth media (Lonza) supplemented with human VEGF-C (R&D) ...
-
bioRxiv - Immunology 2022Quote: ... activated-DC were washed twice in PBS 1X and put in culture with allogeneic naive CD4+ T cells (104 DC and 5×104 T) in X-VIVO 15 media (LONZA) for the indicated time ...
-
bioRxiv - Molecular Biology 2020Quote: ... Gel electrophoresis after visual read-out of the LAMP assay was done by loading 5 µl of the lamp reaction with 5 µl 2x loading dye on a 1.5 % agarose (Seakem LE Agarose, Lonza #50004) together with 5 µl of a 1kB DNA Ladder (Roche) ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were transfected by combining 5×105 viable cells with 400 ng plasmid DNA and nucleofection solution in a 25-μL electroporation cuvette (Lonza). Cells were electroporated according to the manufacturer’s protocol.
-
bioRxiv - Immunology 2022Quote: ... 1*106 purified naïve T-cells were resuspended in 15 μL buffer P3 + 5 μL Supplement 1 (P3 Primary Cell 4D-NucleofectorTM X Kit S; Lonza) and mixed with 2.7 μL RNP in the 16-well strips provided in the kit ...
-
bioRxiv - Biophysics 2022Quote: ... CD146 positive cells were retained in the column and flushed with 5 mL warmed EGM-2 growth medium supplemented with EGM-2 bullet kit (Lonza) into a separate tube ...
-
bioRxiv - Cancer Biology 2022Quote: ... All cells were grown at 37°C and 5% CO2 in a humidified incubator and tested negative for mycoplasma using the MycoAlert Mycoplasma Detection Kit (LT07-318, Lonza).