Labshake search
Citations for Lonza :
3951 - 4000 of 9615 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... All cell lines were confirmed to be negative for mycoplasma (MycoAlert Detection Kit, Lonza LT07-418).
-
bioRxiv - Cancer Biology 2022Quote: ... and cells were nucleofected with Lonza 4D-Nucleofector™ X Unit (Lonza AAF-1002X) with the EN150 program immediately following addition of the RNP solution ...
-
bioRxiv - Cancer Biology 2022Quote: ... RBCs were lysed in 1X red blood cell lysis buffer ACK Lysis Buffer (Lonza 10-548E). Either CD45 magnetic beads or T cell isolation kit (Miltenyi Biotec ...
-
bioRxiv - Cancer Biology 2022Quote: ... RBCs were lysed using ACK Lysis Buffer (Lonza 10-548E) and the blood was further diluted at 1:100 ratio in the cell staining buffer (Biolegend ...
-
bioRxiv - Cancer Biology 2022Quote: ... Red blood cells (RBCs) were lysed using the ACK Lysis buffer (Lonza, 10-548E). Dead cell removal kit (Miltenyi Biotec ...
-
bioRxiv - Cancer Biology 2022Quote: ... All cell lines were routinely tested to confirm lack of Mycoplasma infection (MycoAlert, Lonza, Basel, Switzerland). To generate isogenic Rb-deficient cell lines (Myc-CaPΔRb) ...
-
bioRxiv - Cancer Biology 2022Quote: ... L-glutamine (2 mM, Lonza) and sodium pyruvate (1 mM ...
-
bioRxiv - Cell Biology 2022Quote: ... tested negative for Mycoplasma (Lonza, LT07-318) and were kept in culture for no longer than 2 months.
-
bioRxiv - Developmental Biology 2022Quote: ... and 1 million cells were transfected with 2μg of donor vector and 2μg of each AAVS1 ZFN expression plasmids using the P3 Primary Cell 4D-Nucleofector X Kit (Lonza). Cells were seeded in E8 medium supplemented with 10µM ROCK Inhibitor Y-27632 (Selleckchem) ...
-
bioRxiv - Developmental Biology 2022Quote: Generation of Foxa2 knockout cell lines was performed by electroporating two different guides cloned into the pX458 vector (Ran et al., 2013) with the AMAXA nucleofector kit (Lonza Cat no. VPH-1001). Cells were sorted for GFP as single cells one day after electroporation ...
-
bioRxiv - Cancer Biology 2022Quote: ... and TILs were resuspended at a cell density of 1 million cells in 20 µL P3 electroporation buffer with supplement (Lonza) and then combined with 3 µL of RNP mixture and nucleofected using program DJ-110 (melanoma ...
-
bioRxiv - Cancer Biology 2022Quote: ... and then combined with 3 µL of RNP mixture and nucleofected using program DJ-110 (melanoma) or EH100 (TILs) on a 4D Nucleofector (Lonza). Melanoma cells were immediately recovered in full melanoma media in 12-well plates ...
-
bioRxiv - Cancer Biology 2022Quote: ... Melanoma cells were resuspended at a cell density of 50,000 cells in 20 µL SF electroporation buffer with supplement (Lonza) and TILs were resuspended at a cell density of 1 million cells in 20 µL P3 electroporation buffer with supplement (Lonza ...
-
bioRxiv - Cancer Biology 2022Quote: ... and MycoAlert™ control set (LT07-518, Lonza group Ltd.). The cells were all cultured in humidified sterile incubator conditioned at 5% CO2 at 37°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... dissociation with 1× trypsin (Lonza #BE02-007E), washing again with TC-PBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... The normal human lung fibroblasts NHLF (CC-2512) was purchased from Lonza Group (Switzerland) ...
-
bioRxiv - Cell Biology 2022Quote: ... The linearized targeting vector was introduced by nucleofection (Amaxa; Lonza, Basel, Switzerland) into V6.5 cells ...
-
bioRxiv - Cell Biology 2022Quote: ... five donors of primary healthy HBECs were purchased from Lonza and Epithelix SàRL (Geneva ...
-
bioRxiv - Cell Biology 2022Quote: U2OS cells were grown in RPMI media (Lonza), supplemented with 10% FBS (GIBCO ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were transfected by the AMAXA NucleofectorTM 2b device (Cat# AAB-1001, Lonza, Program A-024) according to manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: ... we used Cas9-RNP and the Lonza 4D-Nucleofector System together with the P4 Primary Cell 4D-Nucleofector X Kit L (Lonza) to transfect and create Ndrg2-KO DCs ...
-
bioRxiv - Cell Biology 2022Quote: ... 2a) per 0.5 million cells that were washed with DPBS and suspended in R Buffer (Lonza). After optimization ...
-
bioRxiv - Cell Biology 2022Quote: ... For nucleofection we used the 4D-Nucleofector System and P3 Primary Cell 4D Nucleofector X Kit L (Lonza, Basel, Switzerland). We optimized the RNP electroporation for DCs by using multiple-guide mixtures and different number of cells in a 100uL total volume ...
-
bioRxiv - Cell Biology 2022Quote: ... followed by washing with 1xPBS (Lonza), and embedding in 30% sucrose solution at 4C until they sink at the bottom (∼2 days) ...
-
bioRxiv - Cell Biology 2022Quote: ... Plasmids were introduced into HCT116 and MDCK cells using nucleofection with the 384-well HT Nucleofector and the SE cell line kit (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... and cultured in DMEM (Dulbecco’s modified Eagle’s medium; Lonza, BE12-604F) supplemented with 10% FBS (fetal bovine serum ...
-
bioRxiv - Cancer Biology 2022Quote: ... the same cells were expanded in IMDM (Lonza Bioscience) with 15% FCS ...
-
bioRxiv - Cancer Biology 2022Quote: ... the culture medium consisted of RPMI (Lonza Bioscience), with 10% FCS ...
-
bioRxiv - Cell Biology 2022Quote: ... All tumor cell lines used in the in vivo experiments were routinely tested for mycoplasma contamination using Mycoalert plus mycoplasma detection kit (Lonza). Randomization of animals was not used in experiments and no blinding was done for the animal experiments.
-
bioRxiv - Cell Biology 2022Quote: Cells in suspension were first washed with PBS (LONZA) and cell numbers adjusted to a concentration of 105 ml−1 in PBS ...
-
bioRxiv - Cell Biology 2022Quote: ... 1uM siRNA was electroporated into cells using the Amaxa Nucleofector II device and Cell Line Nucleofector Kit V (Lonza Bioscience, VCA-1003). B16-F10 cells were electroporated with program P-020 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and mixed by pipetting with the full gRNA-Cas9 complex mix previously assembled then added in the electroporation chamber well (Lonza, V4XP3032). Cells were electroporated with the program EO-100 using the Lonza Nucleofector ...
-
bioRxiv - Cancer Biology 2022Quote: ... 50 000 to 100 000 cells per reaction was then resuspended in 20uL of P3 solution (Lonza, V4XP-3032) and mixed by pipetting with the full gRNA-Cas9 complex mix previously assembled then added in the electroporation chamber well (Lonza ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were maintained in culture for the indicated time in the following medium: X-VIVO 10 (Lonza, BE04-380Q) supplemented with 20% BIT 9500 Serum Substitute (StemCell technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... with final concentrations as indicated: X-VIVO 10 (Lonza, BE04-380Q) supplemented with 20% BIT 9500 Serum Substitute (StemCell technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... penicillin-streptomycin (1:100) (Lonza); 0.4% heparin (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2022Quote: ... All cells were routinely checked for mycoplasma contamination using the MycoAlertTM Mycoplasma Detection Kit (Lonza). For overexpression of CSPP1 constructs ...
-
bioRxiv - Cancer Biology 2022Quote: ... siControl and siIRAK4 were purchased from Horizon Discovery and transfected into human AML samples using Amaxa Nucleofector Kit T (Lonza) (program number G-016 ...
-
bioRxiv - Microbiology 2022Quote: ... Blood schizont purification was performed using a Nycodenz (Axis Shield) gradient following the culture of infected mouse blood in RPMI 1640 (Lonza) supplemented with 50 µg/ml neomycin (Sigma ...
-
bioRxiv - Neuroscience 2022Quote: ... 500ng of pMaxGFP (Lonza), and 3ug of ssODN donor (ccattgcaggtcgtcacgctgtggtacagagcacccgaagtcttgctccagtccagctacAcAacccccgtggatctctg gagtgttggctgcatatttgcagaaatgtttcgtagaaagtaagaaa ...
-
bioRxiv - Neuroscience 2022Quote: ... H9 cells were nucleofected (Lonza, 4D-Nucleofector™ X-unit) with precomplexed ribonuclear proteins (RNPs ...
-
bioRxiv - Neuroscience 2022Quote: ... Lenti-CRISPRv2 plasmid was nucleofected in H1 ESCs using 4D Nucleofector kit (Lonza) and cells were recovered in mTeSR medium ...
-
bioRxiv - Neuroscience 2022Quote: ... at 0,1 μg/mL into a PBS buffer (Lonza) and incubated overnight at 4°C ...
-
bioRxiv - Neuroscience 2022Quote: ... and 252 pmol Cas9-HiFi or Cpf1-Ultra (both IDT) using the B-16 program of the Nucleofector 2b Device (Lonza) in cuvettes for 100 µl Human Stem Cell nucleofection buffer (Lonza ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... USA) and grown in endothelial basal medium (EBM) in combination with endothelial cell growth medium (EGM-2) bullet kit (Lonza, Walkersville, MD, USA). iCEC2 cells were a kind gift from Dr ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were routinely tested for mycoplasma contamination using a MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Neuroscience 2022Quote: ... in cuvettes for 100 µl Human Stem Cell nucleofection buffer (Lonza, VVPH- 5022). Cell were counted with Countess automated cell counter (Invitrogen).
-
bioRxiv - Neuroscience 2022Quote: ... and pCXLE-hUL (#27080) were transfected into fibroblasts using a 4D-Nucleofector system with P2 Primary Cell 4D-Nucleofector X Kit (Lonza; program DT-130). Three to five weeks after reprogramming ...
-
bioRxiv - Neuroscience 2022Quote: ... and 1% penicillin/streptomycin (Lonza) in 15 cm dishes (Nunc ...
-
bioRxiv - Neuroscience 2022Quote: ... were cultured in EGM-2 endothelial cell growth medium-2 from the BulletKit (Lonza, Basel, Switzerland; CC-3162). Pericytes and astrocytes were used for experiments up to passage 4 ...