Labshake search
Citations for Lonza :
351 - 400 of 987 citations for Alpha Cyclodextrin Solution 5% w v since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... diluted from 10× stock solution (17-517Q, Lonza Pharma & Biotech, Maryland, USA).
-
bioRxiv - Bioengineering 2023Quote: ... L-glutamine and penicillin/streptomycin solutions were obtained from Lonza (Amboise, France). Avian DuckCelt®-T17 cell lines (ECACC 09071703 ...
-
bioRxiv - Molecular Biology 2023Quote: Injury media solutions based on Hepatocyte Culture Medium (HCM, Lonza, CC-3198) were prepared to obtain solutions of TGF-β1 (10 ng/mL and 25 ng/mL ...
-
bioRxiv - Neuroscience 2023Quote: ... the cultures were incubated with 1 mL of L7 dissociation solution (Lonza) for 2 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... and resuspended in 15uL of Nucleofector solution from the P3 kit (Lonza) in a 1.5mL microcentrifuge tube ...
-
bioRxiv - Bioengineering 2023Quote: ... the cells were electroporated using SF Cell Line 4D-Nucleofector solution (Lonza) and conditions ...
-
bioRxiv - Bioengineering 2023Quote: ... hepatocytes were electroporated using 100 µL Mouse/Rat Hepatocyte Nucleofector solution (Lonza) and conditions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... K562 were electroporated in Amaxa solution (Lonza Nucleofector 2b, setting T0-16) with 1μg of reporter donor (pEF1a-p450-rapalog-split-TEVP-T2A-mCherry ...
-
bioRxiv - Bioengineering 2024Quote: ... 1x MEM Non-Essential Amino Acids Solution (MEMNEAA) (Lonza, Cat no. 11140050), 1x GlutaMAX Supplement (Gibco ...
-
bioRxiv - Microbiology 2024Quote: ... and 18 μL of SF Cell Line Nucleofector solution (Lonza V4XC-2032). Complexes were mixed and incubated for 10 min at room temperature prior to addition to 5 μL of cells (1e5 for U937 ...
-
bioRxiv - Immunology 2024Quote: ... HUVECs were detached using 0.025% Trypsin-EDTA (1X) solution (CC-5012; Lonza), neutralized with Trypsin Neutralizing Solution (CC-5002 ...
-
bioRxiv - Microbiology 2024Quote: ... followed by a solution of 85% HEPES Buffered Saline (Lonza, Basel, Switzerland) with 15% FBS (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2024Quote: Trypan Blue 0.4% solution (dilute 1:8 in PBS 1X; #17492E, Lonza)
-
bioRxiv - Biochemistry 2020Quote: ... Fractions were pooled and buffer-exchanged to phosphate-buffered saline (PBS; 140 mM NaCl, 5 mM NaH2PO4, 5 mM Na2HPO4, pH 7.4; Lonza, UK) using a Sephadex G-25 column (GE Healthcare ...
-
bioRxiv - Biochemistry 2020Quote: ... Fractions were pooled and buffer-exchanged to phosphate-buffered saline (PBS; 140 mM NaCl, 5 mM NaH2PO4, 5 mM Na2HPO4, pH 7.4; Lonza, UK) using a Sephadex G-25 column (GE Healthcare ...
-
bioRxiv - Cancer Biology 2020Quote: ... The cells were dissociated into single cells with accutase and 1 million cells were used for nucleofection with 5 μg of gRNA/Cas9 plasmid and 5 μg of each donor plasmid (WT and G12D) using Nucleofector II (Lonza) and program B-16 ...
-
bioRxiv - Biochemistry 2020Quote: ... Fractions were pooled and buffer-exchanged to phosphate-buffered saline (PBS; 140 mM NaCl, 5 mM NaH2PO4, 5 mM Na2HPO4, pH 7.4; Lonza, UK) using a Sephadex G-25 column (GE Healthcare ...
-
bioRxiv - Microbiology 2021Quote: ... Fractions were pooled and buffer-exchanged to phosphate-buffered saline (PBS; 140 mM NaCl, 5 mM NaH2PO4, 5 mM Na2HPO4, pH 7.4; Lonza, UK) using Sephadex G-25 media (GE Healthcare ...
-
bioRxiv - Biochemistry 2020Quote: ... Fractions were pooled and buffer-exchanged to phosphate-buffered saline (PBS; 140 mM NaCl, 5 mM NaH2PO4, 5 mM Na2HPO4, pH 7.4; Lonza, UK) using a Sephadex G-25 column (GE Healthcare ...
-
Synthetic lethal targeting of TET2-mutant hematopoietic stem and progenitor cells by XPO1 inhibitorsbioRxiv - Cancer Biology 2022Quote: ... or either of two different gRNAs targeting exon 3 coding sequences of human TET2 (TET2-gRNA #1: 5’-TGGAGAAAGACGTAACTTC-3’ and TET2-gRNA #2: 5’-TCTGCCCTGAGGTATGCGAT-3’) were transfected with Nucleofector (Lonza). After transduction ...
-
bioRxiv - Neuroscience 2024Quote: ... 2.5 × 10 5 phNPCs cells were used per electroporation reaction in one cuvette of the 16-well Nucleocuvette Stripe (Lonza). After trypsinization ...
-
bioRxiv - Cell Biology 2022Quote: ... the mammary glands were digested overnight at 37 ºC and 5% CO2 in a loosely capped 50 ml falcon with 5 ml of DMEM/F12 (Lonza) supplemented with 25 mM HEPES ...
-
bioRxiv - Molecular Biology 2023Quote: ... A cell count ranging from 1 × 10^5 to 2 × 10^5 cells was collected and suspended in 15 µL of nucleofection buffer (Lonza). Electroporations were conducted in the strip format ...
-
bioRxiv - Developmental Biology 2020Quote: ... completed with 5% fetal bovine serum (FBS, Lonza) and 2mM L-glutamine (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2021Quote: ... 2% glutamine and 5% human serum AB (Lonza) for seven days ...
-
bioRxiv - Cell Biology 2021Quote: ... 5% C02 in EGM-2 (Lonza, #CC-3162), media was changed every two days and cultured to passage 6 ...
-
bioRxiv - Physiology 2022Quote: ... (5 g/L trypsin and 2 g/L EDTA diluted 1 in 5 in calcium- and magnesium-free PBS) (Lonza, UK).
-
bioRxiv - Bioengineering 2022Quote: ... for 1.5 h at 37°C and 5% CO2 before seeded with human umbilical vein endothelial cells (HUVECs, pooled donor, Lonza, Switzerland). Endothelial Cell Growth Medium-2 (EGM-2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and transfected using the Lonza Amaxa® Cell Line Nucleofector® Kit V (Lonza, Basel, Switzerland VCA-1003) using electroporation program A30 ...
-
bioRxiv - Immunology 2022Quote: ... 2×106 B cells were then nucleofected with 2 μg of plasmid DNA using Nucleofector Kit V (Lonza) and rested for at least 16-24 hours using complete media containing 5 ng/ml BAFF and lacking LPS ...
-
bioRxiv - Immunology 2020Quote: ... 1×106 cells per guide were electroporated with the corresponding RNP complex using Lonza Electroporation Kit V (Lonza). After 48 h ...
-
bioRxiv - Genomics 2021Quote: ... K562 cells were grown to 1×106 and transfected with 1,000ng of gRNA plasmid and 3,000 ng of pCMV_AncBE4max_P2A_GFP (Amaxa® Cell Line Nucleofector® Kit V, Lonza). K562 cells were cultured for an additional 48 hours then single clones of green cells were isolated using flow cytometry (Aria II) ...
-
bioRxiv - Molecular Biology 2020Quote: ... using the Cell Line Nucelofector Kit V and the Amaxa Nucleofector II Device (Lonza Group AG, Basel, CH). Stable cells were selected for with 1mg/mL hygromycin B (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... EB3-mCherry construct (Stepanova et al., 2003) was transiently transfected using Amaxa Cell Line Nucleofector kit V (Lonza), program X-001.
-
bioRxiv - Cell Biology 2022Quote: ... 25 μg mRNA was transfected into 2.5 × 106 freshly thawed fibroblasts using Cell Line Nucleofector Kit V (Lonza) and AMAXA program X-001 following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... 1×10e6 cells per guide were electroporated with the corresponding RNP complex using Lonza Electroporation Kit V (Lonza). After 48 h ...
-
bioRxiv - Cell Biology 2024Quote: ... containing the appropriate guide RNA (gRNA) sequences (CGCTCAACTCGGCCATGCGC; GCAACAGATGGAAGGCCTCC) using the AmaxaTM nucleofectorTM kit V (Lonza #VCA-1003). Monoclonal lines were screened for puromycin sensitivity ...
-
bioRxiv - Immunology 2024Quote: ... 1 - 2.5 × 106 Jurkat T cells were resuspended in EP buffer from the Nucleofector® Kit V (Lonza). Cells were combined with 1.5 μg of donor plasmid in a reaction volume of 100 μL and electroporated on the Amaxa® Nucleofector® II using pulse code X-005.
-
bioRxiv - Immunology 2024Quote: ... 1×106 cells per guide were electroporated with the corresponding RNP complex using Lonza Electroporation Kit V (Lonza). After 48 h ...
-
bioRxiv - Genetics 2021Quote: ... 8x105 WTC iPSC were nucleofected using Amaxa nucleofector 2B and Solution P3 (Lonza), 80 pmol Truecut v2 Cas9 (Life Technologies) ...
-
bioRxiv - Bioengineering 2021Quote: ... and resuspended in 20 μl P3 Primary Cell Nucleofector Solution (Lonza V4XP-3032). T cells were then nucleofected using the Lonza Nucleofector 4D (program E0-115) ...
-
bioRxiv - Microbiology 2020Quote: ... 10 µl of schizonts was mixed with 100 µl of P3 solution (Lonza) containing 30 µg each of the relevant donor and guide vectors ...
-
bioRxiv - Neuroscience 2022Quote: ... The squares were incubated for 1 minute with L7 hPSC passaging solution (Lonza). After aspirating the L7 solution ...
-
Kinetochore- and chromosome-driven transition of microtubules into bundles promotes spindle assemblybioRxiv - Cell Biology 2022Quote: ... and penicillin (100 IU/mL)/streptomycin (100 mg/mL) solution (Lonza, Basel, Switzerland). For the selection of HeLa PRC1-GFP cell lines ...
-
bioRxiv - Microbiology 2021Quote: Mouse femurs were removed and flushed with Hank’s Buffered Salt Solution (HBSS-Lonza) as described [23] ...
-
bioRxiv - Cancer Biology 2020Quote: ... which included the use of 15-EW program and the SE Solution (Lonza). Thus ...
-
bioRxiv - Cell Biology 2022Quote: ... and penicillin (100 IU/mL)/streptomycin (100 mg/mL) solution (Lonza, Basel, Switzerland). For the selection of U2OS CENP-A-GFP mCherry-α-tubulin PA-GFP-α-tubulin ...
-
bioRxiv - Bioengineering 2022Quote: ... Electroporation of CD34+ HSPCs was performed with P3 nucleofection solution (Lonza, Basel, Switzerland) in the Lonza Nucleofector 4D (program DZ-100) ...
-
bioRxiv - Neuroscience 2022Quote: ... diluted in 0.1M Dulbecco’s Phosphate Buffered Saline (PBS) solution (Lonza, Cat# 12001-664). The slices stayed in the 4% PFA solution for 24-48 hours before being places in a 0.1M PBS solution until histology was performed.
-
bioRxiv - Neuroscience 2022Quote: ... 250,000 oligodendrocyte precursors were gently resuspended into 20 μl of nucleofector solution (Lonza P3 Primary Cell 4D-Nucleofector V4XP-3032 ...