Labshake search
Citations for Lonza :
351 - 400 of 1092 citations for 7 METHOXY 4 4 DIMETHYL 3 4 DIHYDRO 2H NAPHTHALEN 1 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... They were then transfected by nucleofection with 3 μg of plasmid DNA in 100 μl of Cell Line Nucleofector Solution V (Lonza) using the V-001 program (Amaxa Biosystems) ...
-
bioRxiv - Developmental Biology 2020Quote: ... a 1:1 mix containing EGM2-Incomplete (Lonza) and macrophage media (v/v ...
-
bioRxiv - Cancer Biology 2020Quote: ... dissociated into single cell suspension with trypsin-EDTA (Pan-Biotech, Germany) for 3 min followed by trypsin neutralizing solution (Lonza, Germany). Single cell suspensions of secondary mammospheres were obtained as described for day 7-first generation mammospheres.
-
bioRxiv - Immunology 2022Quote: ... were transfected with 0.1 nmol of siRNA oligonucleotides (listed in Supplementary Table 3) using a Human Monocyte Nucleofactor Kit (Lonza, VVPA-1007) and the AMAXA Nucleofector System (Lonza ...
-
bioRxiv - Developmental Biology 2019Quote: ... 4 μg of the donor ssDNA and 3 μg of a puromycin resistance plasmid (pCAG-puroR) using the Mouse ES Cell Nucleofector™ Kit (Lonza) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... Slices were immediately placed in a 6-well plate containing 3 mL per well of “complete RPMI”: RPMI (Lonza, 16-167F) supplemented with 10 % FBS (VWR ...
-
bioRxiv - Molecular Biology 2024Quote: ... All cell lines were confirmed to be mycoplasma negative every 3 weeks (MycoAlert™ Mycoplasma Detection Kit, Lonza, Bend, OR, USA). Fifteen micrograms of total whole cell lysates (WCL ...
-
bioRxiv - Genetics 2023Quote: ... The RNP complex together with 7 µg of donor DNA was nucleofected into 3 × 107 ISE6 cells using EN150 and buffer SF via the 4D-Nucleofector system (Lonza Bioscience) (Figure S1) ...
-
bioRxiv - Bioengineering 2024Quote: ... Cells were cultured at passage 3 and seeded in triplicate in hMSC Growth Medium (MSCGM™ Mesenchymal Stem Cell Growth Medium, Lonza) with 10% FBS ...
-
bioRxiv - Immunology 2024Quote: ... were transfected with 0.1 nmol of siRNA oligonucleotides (listed in Extended Data Table 3) using a Human Monocyte Nucleofactor Kit (Lonza, VVPA-1007) and the AMAXA Nucleofector System (Lonza ...
-
bioRxiv - Systems Biology 2023Quote: ... 5% CO2 in 1:1 RPMI:MEGM (Lonza, #CC-3151), 3% fetal bovine serum (FBS,Gibco) ...
-
bioRxiv - Bioengineering 2023Quote: ... engineered GVs at OD500 = 3.6 were mixed 1:1 with 1% w/v agarose (Lonza, #50070) in MOPS buffer with 400 µM CaCl2 or 10 mM EGTA (final OD500 = 1.8 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5 µg of PX459 gRNA vector (5’-GACTCCAGTCTTTCTAGAAGA-3’) were nucleofected with the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-100) using program A-30 in the XRep ...
-
bioRxiv - Developmental Biology 2021Quote: ... 4 μg of the donor ssDNA and 3 μg of a puromycin resistance plasmid (pCAG-puroR) using the Mouse ES Cell Nucleofector™ Kit (Lonza, Switzerland) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... Cell lines are cultivated at 37°C with 5% CO2 and were tested every 3 months for mycoplasma contamination using Universal Mycoplasma detection kit (ATCC, 30-1012K) or MycoAlert Plus Mycoplasma Detection Ki (Lonza, LT07-701). Cell lines were used no more than 30 passages.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... A high resistance Plastiape® RS00 inhaler (Plastiape S.p.A, Osnago, Italy) containing size #3 HPMC capsules (V-Caps® Plus, Lonza, Morristown, NJ) and 1-3 mg of powder was attached to a USP induction port by a molded silicon adapter ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... were seeded onto 96-well plates at a density of 3×104 cells per well in 100 μL cell culture media that consisted of DMEM (Lonza, Basel, Switzerland), 1% penicillin–streptomycin (Lonza ...
-
bioRxiv - Microbiology 2023Quote: ... Full-thickness samples were obtained by 12 mm punch and placed in 12-well plates containing 3 mL Dulbecco’s Modified Eagle Medium (DMEM) (Lonza, Walkersville, MD, USA) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were regularly passaged 2-3 times a week and routinely tested for mycoplasma contamination using MycoAlert Plus mycoplasma Detection kit (Lonza, #LT07-710).
-
bioRxiv - Genomics 2024Quote: ... and electroporated with 6 μg of gRNA-Cas9 expression vector and 3 μg of SNRPN targeting vector using the P3 Primary Cell 4D-Nucleofector Kit (Lonza, V4XP-3032). Transfected cells were plated into a 10 cm dish coated with Matrigel (Corning ...
-
bioRxiv - Immunology 2022Quote: ... 1% penicillin-streptomycin and 1% Ultra-glutamine (both from Lonza) RPMI 1640 media ...
-
bioRxiv - Neuroscience 2019Quote: ... 1% NEAA (Lonza), 1% N2 supplement (Thermo Scientific) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1% Ultraglutamine (Lonza)) in each well ...
-
bioRxiv - Genetics 2022Quote: ... 1% glutamine (Lonza) and 1% penicillin-streptomycin (Sigma) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Five milligrams of niclosamide inhalation powder was loaded into size #3 hydroxypropyl methylcellulose capsules (Vcaps® plus, Capsugel®, Lonza, Morristown, NJ, USA). The aerodynamic properties of the powder were evaluated using a Next Generation Impactor (NGI ...
-
bioRxiv - Neuroscience 2022Quote: ... Harvested EBs were transferred to a tissue-culture treated 6-well plate (Falcon, #353224) in 3 ml of EB Differentiation media: X-VIVO 15 (Lonza Biosciences, #04-418Q) + 1% Glutamax (Life Technologies ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Molecular Biology 2019Quote: ... ES cells were grown in 1:1 mixture of DMEM (Lonza BioWhittaker Cat ...
-
bioRxiv - Cell Biology 2021Quote: ... neutralized 1:1 with Trypsin Neutralising Solution (TNS, Lonza, #CC-5002), spun down and concentrated to 15*106 cells/mL in EGM-2 ...
-
bioRxiv - Microbiology 2021Quote: ... 1% penicillin/streptomycin and 1% sea-plaque agarose (Lonza, Walkersville, MD). After a 2-days incubation ...
-
bioRxiv - Microbiology 2022Quote: ... A 1:1 mixture of Bronchial Epithelial Cell Basal Medium (Lonza) with Dulbecco’s Modified Eagle Medium (DMEM ...
-
bioRxiv - Immunology 2024Quote: ... at a 1:1 ratio overnight in X Vivo-15 (Lonza) supplemented with 2% KnockOut serum replacement (ThermoFisher) ...
-
bioRxiv - Genetics 2021Quote: Human embryonic microglia clone 3 (HMC3, ATCC® CRL3304™) cells were cultured in minimum essential medium (MEM) Eagle-EBSS with NEAA without L-Glutamine (Lonza, Cologne, Germany) supplemented with 10% fetal bovine serum (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: hTERT immortalized RPE-1 (RPE1) cell lines were grown in an 1:1 mix of DMEM and F-10 (Lonza) and Human Embryonic Kidney (HEK ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... 100mM EDTA at pH 8.0 and 1 mg ml−1 lysozyme and mixed with the same volume of 1% SeaKem Gold Agarose (Lonza, USA) in TE buffer containing 10 mM Tris ...
-
bioRxiv - Synthetic Biology 2022Quote: 1 x 106 BHK-21 cells were electroporated with a total of 7.8 μg of mRNA (1:1:1 of pSinHelper, pSinCapsid and pTSin-EGFP/pTSin-SRF-NLS-VP64) using Amaxa 2B (Lonza) as per the manufacturer’s instructions for BHK-21 cells ...
-
bioRxiv - Physiology 2019Quote: ... 50 ng.mL−1 amphotericin B and 10 μg.ml−1 heparin (BulletKitTM, Lonza). Experiments were performed on cells from passage 2-5 ...
-
bioRxiv - Microbiology 2020Quote: ... 100 IU ml-1 penicillin-100 µg ml-1 streptomycin mixture (Lonza), 2 mM L-glutamine (Lonza) ...
-
bioRxiv - Microbiology 2020Quote: ... 100 IU ml-1 penicillin-100 µg ml-1 streptomycin mixture (Lonza), 200 mM L-glutamine (Lonza) ...
-
bioRxiv - Cell Biology 2019Quote: ... and 1 % antibiotic (Lonza). U2OS osteosarcoma cells were cultured at 37 °C in DMEM (Dulbecco’s Modified Eagle Medium ...
-
bioRxiv - Genomics 2020Quote: ... 1% Na-pyruvate (Lonza), 1% antibiotic-antimycotic solution (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... 1% penicillin streptomycin (Lonza), 100 μM L-ascorbic acid (Sigma) ...
-
bioRxiv - Cell Biology 2021Quote: ... 1% streptomycin/penicillin (Lonza), at 37° C with 5% CO2 and humidified atmosphere ...
-
bioRxiv - Cell Biology 2020Quote: ... 1% penicillin/streptomycin (Lonza), 20 ng/mL EGF (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: ... all cells were centrifuged at 220 xg RT for 5 min followed by resuspension with fresh complete media and plated at 1:5 (Cell Systems cells)-1:10 (Lonza cells) dilutions ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1% Glutamine (Lonza), and seeded on Xona silicon device (#RD450 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1% penicillin/streptomycin (Lonza), and 1% L-glutamine (Lonza) ...
-
bioRxiv - Immunology 2022Quote: ... 1% L-glutamine (Lonza), and ...
-
bioRxiv - Genomics 2020Quote: ... 1% Na-pyruvate (Lonza), 1% non-essential amino acid solution (Lonza) ...