Labshake search
Citations for Lonza :
351 - 400 of 1249 citations for 6 Chloro 3 4 dihydro 4 methyl 3 oxo 2H 1 4 benzoxazine 8 carboxylic Acid d3 Methyl Ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... were annealed to Cas9 protein (IDT) and the ribonucleoprotein complex was transfected into SKOV-3 cells using a 4D-Nucleofector (Lonza). Bulk transfected cells were checked by flow cytometry for successful knock-down ...
-
bioRxiv - Physiology 2024Quote: ... counted and 3.106 cells resuspended in 100 μl Nucleofactor R solution and electroporated with 3 µg of plasmid (pcDNA3 containing or not α7-5HT3 cDNA) using the Amaxa nucleofactor kit R (Lonza) according to the manufacturer instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.3×106 live cells were resuspended with the RNP complex and 20 µL of P3 Primary Cell Nucleofector Solution (Lonza), following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... 1 × 106 cells were transfected with 8 μg ScaI-linearized plasmid using the Amaxa Nucleofector (Lonza) SF kit on program DS-113 ...
-
bioRxiv - Cancer Biology 2020Quote: ... dissociated into single cell suspension with trypsin-EDTA (Pan-Biotech, Germany) for 3 min followed by trypsin neutralizing solution (Lonza, Germany). Single cell suspensions of secondary mammospheres were obtained as described for day 7-first generation mammospheres.
-
bioRxiv - Immunology 2022Quote: ... were transfected with 0.1 nmol of siRNA oligonucleotides (listed in Supplementary Table 3) using a Human Monocyte Nucleofactor Kit (Lonza, VVPA-1007) and the AMAXA Nucleofector System (Lonza ...
-
bioRxiv - Molecular Biology 2024Quote: ... All cell lines were confirmed to be mycoplasma negative every 3 weeks (MycoAlert™ Mycoplasma Detection Kit, Lonza, Bend, OR, USA). Fifteen micrograms of total whole cell lysates (WCL ...
-
bioRxiv - Immunology 2024Quote: ... were transfected with 0.1 nmol of siRNA oligonucleotides (listed in Extended Data Table 3) using a Human Monocyte Nucleofactor Kit (Lonza, VVPA-1007) and the AMAXA Nucleofector System (Lonza ...
-
bioRxiv - Bioengineering 2024Quote: ... Cells were cultured at passage 3 and seeded in triplicate in hMSC Growth Medium (MSCGM™ Mesenchymal Stem Cell Growth Medium, Lonza) with 10% FBS ...
-
bioRxiv - Genetics 2023Quote: ... The RNP complex together with 7 µg of donor DNA was nucleofected into 3 × 107 ISE6 cells using EN150 and buffer SF via the 4D-Nucleofector system (Lonza Bioscience) (Figure S1) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... non-essential amino acids (Lonza), 10 percent heat-inactivated FBS (GE Healthcare Bio-Sciences) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... non-essential amino acids (Lonza), and 10 percent heat-inactivated FBS (Hyclone) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... non-essential amino acids (Lonza), and 10% heat-inactivated FBS (Hyclone).
-
bioRxiv - Microbiology 2020Quote: ... 1x nonessential amino acids (Lonza) and 20 µg ml-1 trypsin (Lonza) ...
-
bioRxiv - Immunology 2022Quote: ... amino acid (NEAA 100x Lonza) and Penicillin-Streptomycin (Gibco ...
-
bioRxiv - Physiology 2022Quote: ... ascorbic acid (CC-4116C, Lonza), bovine brain extract (CC-4092C ...
-
bioRxiv - Molecular Biology 2022Quote: ... ascorbic acid (#CC-4116C, Lonza), bovine brain extract (#CC-4092C ...
-
bioRxiv - Cell Biology 2023Quote: ... non-essential amino acids (Lonza) and leukaemia inhibitory factor (1000 U/ml ...
-
bioRxiv - Microbiology 2024Quote: ... Erythrocyte cultures were established in 6 well plates using HL-1 medium (Lonza, Basel, Switzerland) supplemented with 20% human serum type A+ (Interstate Blood Bank) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and E15.5 (n=2–6) Six2-TROMA-1 stained kidneys were embedded in 1 % low melting agar (50100; Lonza Group). The lateral cortex of the kidneys was imaged with a Nikon A1R MP+ multiphoton microscope (Tokyo ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5 µg of PX459 gRNA vector (5’-GACTCCAGTCTTTCTAGAAGA-3’) were nucleofected with the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-100) using program A-30 in the XRep ...
-
bioRxiv - Developmental Biology 2021Quote: ... 4 μg of the donor ssDNA and 3 μg of a puromycin resistance plasmid (pCAG-puroR) using the Mouse ES Cell Nucleofector™ Kit (Lonza, Switzerland) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... Cell lines are cultivated at 37°C with 5% CO2 and were tested every 3 months for mycoplasma contamination using Universal Mycoplasma detection kit (ATCC, 30-1012K) or MycoAlert Plus Mycoplasma Detection Ki (Lonza, LT07-701). Cell lines were used no more than 30 passages.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... A high resistance Plastiape® RS00 inhaler (Plastiape S.p.A, Osnago, Italy) containing size #3 HPMC capsules (V-Caps® Plus, Lonza, Morristown, NJ) and 1-3 mg of powder was attached to a USP induction port by a molded silicon adapter ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... were seeded onto 96-well plates at a density of 3×104 cells per well in 100 μL cell culture media that consisted of DMEM (Lonza, Basel, Switzerland), 1% penicillin–streptomycin (Lonza ...
-
bioRxiv - Genomics 2024Quote: ... and electroporated with 6 μg of gRNA-Cas9 expression vector and 3 μg of SNRPN targeting vector using the P3 Primary Cell 4D-Nucleofector Kit (Lonza, V4XP-3032). Transfected cells were plated into a 10 cm dish coated with Matrigel (Corning ...
-
bioRxiv - Microbiology 2023Quote: ... Full-thickness samples were obtained by 12 mm punch and placed in 12-well plates containing 3 mL Dulbecco’s Modified Eagle Medium (DMEM) (Lonza, Walkersville, MD, USA) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were regularly passaged 2-3 times a week and routinely tested for mycoplasma contamination using MycoAlert Plus mycoplasma Detection kit (Lonza, #LT07-710).
-
bioRxiv - Neuroscience 2024Quote: ... A total of 3 × 106 cells were centrifuged and nucleofected using the P3 Primary Cell 4D-Nu-cleofector X Kit L (Lonza, V4XP-3024), a 4D-nucleofector core unit ...
-
bioRxiv - Bioengineering 2024Quote: ... 1,000,000 NIH/3T3 cells were centrifuged (200× g, 3 minutes) and resuspended in 100 µl of the SG Cell Line nucleofection Kit (Lonza, V4XC-3024). After the addition of 500 ng plasmid DNA encoding the hyperactive PiggyBac transposase and 1000 ng of the NTVE knock-in plasmid ...
-
bioRxiv - Bioengineering 2023Quote: ... Electroporation in Hepa 1-6 cells was carried out with a 4D Nucleofector X Unit (Lonza) using the CM-138 program as described in (34) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Five milligrams of niclosamide inhalation powder was loaded into size #3 hydroxypropyl methylcellulose capsules (Vcaps® plus, Capsugel®, Lonza, Morristown, NJ, USA). The aerodynamic properties of the powder were evaluated using a Next Generation Impactor (NGI ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Microbiology 2020Quote: ... 1X non-essential amino acids (Lonza), 1mM sodium pyruvate (Gibco) ...
-
bioRxiv - Microbiology 2020Quote: ... non-essential amino acids (1X, Lonza), penicillin (100 IU/mL ...
-
bioRxiv - Microbiology 2020Quote: ... and 1x nonessential amino acids (Lonza) and 20 μg/ml N-tosyl-l-phenylalanine chloromethyl ketone (TPCK ...
-
bioRxiv - Microbiology 2020Quote: ... and 1x nonessential amino acids (Lonza). Vero-118 cells were cultured in Iscove’s Modified Dulbecco’s Medium (IMDM ...
-
bioRxiv - Microbiology 2020Quote: ... and 1x nonessential amino acids (Lonza).
-
bioRxiv - Genomics 2022Quote: ... 1X non-essential amino acids (Lonza), 1X Glutamax ...
-
bioRxiv - Genetics 2021Quote: Human embryonic microglia clone 3 (HMC3, ATCC® CRL3304™) cells were cultured in minimum essential medium (MEM) Eagle-EBSS with NEAA without L-Glutamine (Lonza, Cologne, Germany) supplemented with 10% fetal bovine serum (Sigma-Aldrich ...
-
bioRxiv - Genomics 2022Quote: ... Following 6-TG treatment 5×106 HM-1 cells were transfected using a Nucleofector®-4D (Lonza) with the P3 Primary Cell X kit ...
-
bioRxiv - Microbiology 2021Quote: An 8% SeaPlaque GTG Agarose (Lonza, Basel, Switzerland) solution in Ultra Pure Water (Genesee Scientific ...
-
bioRxiv - Immunology 2023Quote: ... different tumor cell lines were stained with carboxyfluorescein succinimidyl ester (CFSE) following the manufacture’s protocols and cultured in X-vivo (Lonza) supplemented with 5% FBS (Gbico ...
-
bioRxiv - Biophysics 2021Quote: ... 0.1 mM non-essential amino acids (Lonza), 1 mM sodium pyruvate (Life technologies ...
-
bioRxiv - Immunology 2021Quote: ... 100 μM non-essential amino acids (Lonza), 1 mM sodium pyruvate (VWR) ...
-
bioRxiv - Biophysics 2020Quote: ... 0.1 mM non-essential amino acids (Lonza), 1 mM sodium pyruvate (Life technologies ...
-
bioRxiv - Bioengineering 2021Quote: ... 100 uM MEM nonessential amino acids (Lonza), 1mM sodium pyruvate (Gibco) ...
-
bioRxiv - Microbiology 2021Quote: ... 1X Non-essential Amino Acids (NEAA, Lonza), and 1x Penicillin-Streptomycin (Gibco ...
-
bioRxiv - Cell Biology 2022Quote: ... 1X Non-Essential Amino acids (NEAA; Lonza). Cells were maintained in a humidified cell incubator ...