Labshake search
Citations for Lonza :
251 - 300 of 1447 citations for tert Butyl 2 chloro 5H pyrrolo 3 4 b pyridine 6 7H carboxylate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: ... Cells were expanded in EGM-2 MV media (EBM-2 supplemented with Lonza’s SingleQuot supplements ...
-
bioRxiv - Bioengineering 2022Quote: ... were obtained from Thermo Fisher Scientific and cultured with EGM-2 medium (EGM™-2 BulletKit™, Lonza). Once reached 80-90% confluency ...
-
bioRxiv - Molecular Biology 2024Quote: ... and resuspended in EBM™-2 (Endothelial Cell Growth Basal Medium-2, Lonza). 500 μl EGM-2 BulletKit™ culture medium (with full supplements ...
-
bioRxiv - Bioengineering 2024Quote: ... Cells were expanded in EGM-2 MV media (EBM-2 supplemented with Lonza’s SingleQuot supplements ...
-
bioRxiv - Bioengineering 2024Quote: ... Cells were expanded in EGM-2 MV media (EBM-2 supplemented with Lonza’s SingleQuot supplements ...
-
bioRxiv - Bioengineering 2023Quote: ... containing Microvascular Endothelial Cell Growth Medium-2 SingleQuots Kit (EGM-2 MV, Lonza). Both cell lines proliferate at the permissive temperature of 33°C and maturate at 37°C.
-
bioRxiv - Immunology 2023Quote: ... were cultured in endothelial cell basal medium-2 (EBM-2: Lonza, Basel, Switzerland) supplemented with the EGM-2 MV SingleQuots kit (Lonza) ...
-
bioRxiv - Bioengineering 2023Quote: ... were cultured on dishes in Endothelial Cell Growth Medium-2 (EGM-2; Lonza). Normal human dermal fibroblasts (NHDFs ...
-
bioRxiv - Cell Biology 2024Quote: ... were cultured in EC growth medium-2 (EGM™-2 Bulletkit™; Lonza) containing growth factors or MCDB 131 (Gibco ...
-
bioRxiv - Immunology 2024Quote: ... supplemented with 10 mM N’-2-Hydroxyethylpiperazine-N’-2 ethanesulphonic acid (HEPES, Lonza), 2 mM Glutamax (Gibco) ...
-
bioRxiv - Bioengineering 2024Quote: ... were cultured in Endothelial Cell Growth Medium-2 (EGM-2) (Lonza; CC-3162) supplemented with 1% PenStrep with media changes every 2 days and passages at 1:3 ratio when confluent ...
-
bioRxiv - Genomics 2024Quote: ... supplemented with Smooth Muscle Medium-2 SingleQuots Kit (SmGM-2, CC-4149, Lonza) (complete media) ...
-
bioRxiv - Neuroscience 2021Quote: ... embedded in 3% agarose (Lonza, # 50004, Rockland, ME, USA) and coronally sectioned (Leica VT1000S vibratome ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and the cell pellet was resuspended in Keratinocyte Growth Medium-2 Bullet Kit (KGM2 medium) consisting of KGM-2 Basal Medium and KGM-2 SingleQuots Supplements (Lonza, Basel, Switzerland), and then seeded onto Petri dishes coated with collagen IV ...
-
bioRxiv - Microbiology 2022Quote: ... NHBE cells were infected with viruses at an MOI of 0.01 and cultured in B-ALI growth medium (Lonza) at 33°C ...
-
bioRxiv - Developmental Biology 2020Quote: ... Cells were nucleofected with 10ug lineage recorder DNA and 1ug Sleeping Beauty transposase following the manufacturer’s protocol and using the B-16 program of the Nucleofector 2b (Lonza) in cuvettes for 100μl Human Stem Cell nucleofection buffer (Lonza ...
-
bioRxiv - Cell Biology 2021Quote: ... were grown in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% (v/v) fetal bovine serum (FBS) and 1X penicillin/streptomycin/amphotericin B (Lonza) at 37°C with 5% CO2 ...
-
bioRxiv - Bioengineering 2023Quote: ... 0.1% r-human fibroblast growth factor (rhFGF) and 0.1% Gentamicin sulfate amphotericin-B (GA-1000) (Lonza, Quakertown, PA, USA). HLFs were used from passages 1 to 10 ...
-
bioRxiv - Immunology 2024Quote: ... plasmid containing the sgRNA sequence: GGGGCCACTAGGGACAGGAT using nucleofection according to the manufacturer’s specifications (Lonza 4D Nucleofector, B-cell protocol) at a DNA mass ratio of 4:1 donor to Cas9 plasmid ...
-
bioRxiv - Cell Biology 2020Quote: ... and maintained in endothelial cell medium-2 (EGM-2 - Clonetics, Lonza, Walkersville, MD, USA) supplemented with endothelial growth medium (EGM ...
-
bioRxiv - Cell Biology 2020Quote: ... grown in endothelial basal cell medium 2 supplemented with EGM-2 Singlequot supplements (Lonza). HUVECs maintained at 37°C in a humidified atmosphere of 5% CO2 and used between passages 1-5 ...
-
bioRxiv - Systems Biology 2021Quote: ... TIME cells were cultured in Endothelial Cell Growth Medium-2 BulletKitTM (EGM-2, Lonza). All cell cultures utilized in this study were maintained at 5% CO2 atmosphere and 37°C.
-
bioRxiv - Bioengineering 2022Quote: ... supplemented with EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (Lonza, USA). HUVECs were used between passages 3– 6 ...
-
bioRxiv - Bioengineering 2022Quote: ... and supplemented with an Endothelial Growth Media-2 (EGM-2) SingleQuots Kit (Lonza, MD). Since liver sinusoid ECs results in higher (7.13 fold higher ...
-
bioRxiv - Bioengineering 2020Quote: ... the media was switched to Endothelial Basal Medium 2 (EBM-2) (Lonza, Walkersville, MD) with 2% FBS ...
-
bioRxiv - Cell Biology 2020Quote: ... were cultured in endothelial growth medium (basal medium-2 (EBM-2, Lonza CC-3156) supplemented with Endothelial Cell Growth Medium (EGM)-2 Bullet Kit (CC-3162 ...
-
bioRxiv - Cell Biology 2020Quote: ... and maintained in endothelial cell medium-2 (EGM-2 -Clonetics, Lonza, Walkersville, MD, USA) supplemented with endothelial growth medium (EGM ...
-
bioRxiv - Microbiology 2021Quote: ... were purchased from Cell Biologics (H-6023) and grown in EC basal medium-2 MV (EBM-2 MV; Lonza) supplemented with EGM-2 MV SingleQuots (Lonza ...
-
bioRxiv - Physiology 2022Quote: ... were maintained in EGM™-2 (Endothelial Cell Growth Medium-2 BulletKit™;Lonza) at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... Endothelial cell growth basal medium-2 (EBM-2) was purchased from Lonza (Kingston, ON).
-
bioRxiv - Molecular Biology 2024Quote: ... were maintained in EGM™-2 (Endothelial Cell Growth Medium-2 BulletKit™; Lonza) at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... HUVEC: EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (Lonza, CC-3162). T-cells ...
-
bioRxiv - Bioengineering 2024Quote: ... were cultured using Endothelial Cell Growth Basal Medium-2 (EBM-2; #CC-3156, Lonza) supplemented with 10% FBS and 1% antibiotic-antimycotic and endothelial cell growth supplement (#CC-4176 ...
-
bioRxiv - Bioengineering 2023Quote: ... were maintained in EGM™ -2 Endothelial Cell Growth Medium-2 BulletKit™ (Lonza). Spent media was exchanged with fresh media every three days for 10T1/2 cells and two days for HCAECs ...
-
bioRxiv - Cell Biology 2024Quote: ... LSECs were cultured in endothelial cell basal medium-2 (EBM-2, Lonza, CC-3162). THP-1 cells were cultured in suspension in RPMI 1640 Media (Cytiva ...
-
bioRxiv - Physiology 2024Quote: ... were cultured in supplemented endothelial growth media-2 (Lonza EGM-2 BulletKit, #CC-3162) per the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Hepa1-6 were transfected with both plasmids using the 4D-Nucleofector™ System (Lonza) using the EH-100 program in SF buffer ...
-
bioRxiv - Physiology 2023Quote: ... Passage 5-6 human umbilical vein endothelial cells were resuspended in EGM-2MV (Lonza) and combined with siRNAs ...
-
bioRxiv - Physiology 2023Quote: ... 6 of the samples were randomly selected and stained with AdipoRed (Lonza, Walkersville, MD) (1:35 ...
-
bioRxiv - Microbiology 2024Quote: ... placed in 6 well plates and grown to confluence in EBM (CC-3156, Lonza) complete media (with supplements EGMTM-2 SingleQuotsTM Supplements (CC-4176 ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mM Ultraglutamine 1 (Lonza) and 1× MycoZap antibiotics (Lonza ...
-
bioRxiv - Genetics 2020Quote: ... 2 mM L-glutamine (Lonza), and 50 U·ml-1 penicillin and 50 μg·ml-1 streptomycin (Invitrogen) ...
-
bioRxiv - Cell Biology 2020Quote: ... cultured in FGM-2 (Lonza). AFT024 and BFC024 immortalized mesenchymal stromal cell lines were obtained from Lemishka’s group (Moore et al. ...
-
bioRxiv - Systems Biology 2020Quote: ... 2 mM L-glutamine (Lonza), and 20 mg/L gentamicin (Lonza) ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 mM L-Glu (Lonza, #17-602E ...
-
bioRxiv - Microbiology 2021Quote: ... 2 mM penicillin-streptomycin (Lonza), and 10% heat-inactivated fetal bovine serum (Life Technologies) ...
-
bioRxiv - Microbiology 2020Quote: ... 2 mM L-Glutamine (Lonza), 12.5 μg/ml Amphotericin B (Biowest ...
-
bioRxiv - Physiology 2022Quote: ... 2 mM EDTA (Lonza, UK) in PBS ...
-
bioRxiv - Bioengineering 2022Quote: ... or EGM-2 BulletKit (Lonza), with passages 2-6 used in experiments ...
-
bioRxiv - Cancer Biology 2022Quote: ... L-glutamine (2 mM, Lonza) and sodium pyruvate (1 mM ...