Labshake search
Citations for Lonza :
251 - 300 of 2237 citations for 7 3S 5S 3 Amino 5 methyl 1 piperidinyl 1 cyclopropyl 1 4 dihydro 8 methoxy 4 oxo 3 quinolinecarboxylic acid with 2 hydroxybutanedioic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... the suspension was centrifuged (215g for 5min at 4°C) and the pellet was resuspended in BMEC-media that comprised of EBM-2 medium (Lonza) supplemented with the following ...
-
bioRxiv - Cancer Biology 2019Quote: ... insulin and 3% fetal bovine serum (FBS) (Lonza, #CC-4123). MO3.13 ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR products were resolved on 3% Metaphor agarose gel (Lonza), and DNA fragments of sizes approximately 150-200 nt were isolated from the gel using Qiagen’s Gel Extraction Kit (Figure 1D) ...
-
bioRxiv - Bioengineering 2020Quote: ... Cells were maintained in FGM-3 Medium (CC-4526, Lonza) and passaged at 80% confluence.
-
bioRxiv - Microbiology 2022Quote: Sterile molten top NA (3 mL; 0.2 % SeaPlaque Agarose, Lonza) supplemented with CaCl2 and MgCl2 (both at 5 mM ...
-
bioRxiv - Neuroscience 2022Quote: ... brains were embedded in 3% agarose (SeaKem LE Agarose, Lonza). 150 μm thick vibratome sections (VT1000S vibratome ...
-
bioRxiv - Neuroscience 2022Quote: ... brains were embedded in 3% agarose (SeaKem LE Agarose, Lonza) and vibratome-sectioned (VT1000S vibratome ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... CF patient# 3 (#28388-0000450918, Lonza, male, 25 years-old) and four non-CF donors with no pathology reported ...
-
bioRxiv - Systems Biology 2024Quote: ... and finally resuspended in a cold SSC cocktail (3× Lonza AccuGENE SSC ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were regularly passaged 2-3 times a week and routinely tested for mycoplasma contamination using MycoAlert Plus mycoplasma Detection kit (Lonza, #LT07-710).
-
bioRxiv - Cell Biology 2022Quote: hTERT immortalized RPE-1 (RPE1) cell lines were grown in an 1:1 mix of DMEM and F-10 (Lonza) and Human Embryonic Kidney (HEK ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... 100mM EDTA at pH 8.0 and 1 mg ml−1 lysozyme and mixed with the same volume of 1% SeaKem Gold Agarose (Lonza, USA) in TE buffer containing 10 mM Tris ...
-
bioRxiv - Synthetic Biology 2022Quote: 1 x 106 BHK-21 cells were electroporated with a total of 7.8 μg of mRNA (1:1:1 of pSinHelper, pSinCapsid and pTSin-EGFP/pTSin-SRF-NLS-VP64) using Amaxa 2B (Lonza) as per the manufacturer’s instructions for BHK-21 cells ...
-
bioRxiv - Physiology 2019Quote: ... 50 ng.mL−1 amphotericin B and 10 μg.ml−1 heparin (BulletKitTM, Lonza). Experiments were performed on cells from passage 2-5 ...
-
bioRxiv - Microbiology 2020Quote: ... 100 IU ml-1 penicillin-100 µg ml-1 streptomycin mixture (Lonza), 2 mM L-glutamine (Lonza) ...
-
bioRxiv - Microbiology 2020Quote: ... 100 IU ml-1 penicillin-100 µg ml-1 streptomycin mixture (Lonza), 200 mM L-glutamine (Lonza) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Cancer Biology 2020Quote: ... CHO-S cells were resuspended at a density of 4 mio cells/mL in ProCHO 4 medium (Lonza, #LZ-BE12-029Q) supplemented with 8 mM ultraglutamine (Lonza ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... were obtained from Lonza and maintained in endothelial cell basal medium-2 plus 1% FBS and essential growth factors (Lonza).
-
bioRxiv - Cell Biology 2019Quote: ... and 1 % antibiotic (Lonza). U2OS osteosarcoma cells were cultured at 37 °C in DMEM (Dulbecco’s Modified Eagle Medium ...
-
bioRxiv - Genomics 2020Quote: ... 1% Na-pyruvate (Lonza), 1% antibiotic-antimycotic solution (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... 1% penicillin streptomycin (Lonza), 100 μM L-ascorbic acid (Sigma) ...
-
bioRxiv - Cell Biology 2021Quote: ... 1% streptomycin/penicillin (Lonza), at 37° C with 5% CO2 and humidified atmosphere ...
-
bioRxiv - Cell Biology 2020Quote: ... 1% penicillin/streptomycin (Lonza), 20 ng/mL EGF (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: ... all cells were centrifuged at 220 xg RT for 5 min followed by resuspension with fresh complete media and plated at 1:5 (Cell Systems cells)-1:10 (Lonza cells) dilutions ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1% Glutamine (Lonza), and seeded on Xona silicon device (#RD450 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1% penicillin/streptomycin (Lonza), and 1% L-glutamine (Lonza) ...
-
bioRxiv - Immunology 2022Quote: ... 1% L-glutamine (Lonza), and ...
-
bioRxiv - Genomics 2020Quote: ... 1% Na-pyruvate (Lonza), 1% non-essential amino acid solution (Lonza) ...
-
bioRxiv - Immunology 2020Quote: ... 1% P/S (Lonza), and 1 mM L-Gln (Lonza ...
-
bioRxiv - Immunology 2020Quote: ... 1% Pen/Strep (Lonza), 1% GlutaMAX™(Gibco) ...
-
bioRxiv - Biophysics 2022Quote: ... 1% penicillin–streptomycin (Lonza) and 2 mM L-glutamine (Lonza) ...
-
bioRxiv - Genomics 2022Quote: ... 1% penicillin-streptomycin (Lonza), 0.1 mM β-mercaptoethanol and 4 ng/ml FGF2 ...
-
bioRxiv - Immunology 2022Quote: ... 1% p/s (Lonza) (sort medium ...
-
bioRxiv - Immunology 2022Quote: ... 1% penicillin-streptomycin (Lonza) and 1% Ultra-glutamine (Lonza) ...
-
bioRxiv - Pathology 2022Quote: ... 1% L-glutamine (Lonza), and 0.1 mM 2-mercaptoethanol (Thermo-Fisher) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1% L-Glutamine (Lonza), 0,4% sodium-pyruvate (Sigma ...
-
bioRxiv - Biochemistry 2023Quote: ... and 1% HEPES (Lonza)) ...
-
bioRxiv - Biochemistry 2023Quote: ... 1% sodium pyruvate (Lonza), 1% 1xnonessential amino acids (Lonza) ...
-
bioRxiv - Microbiology 2024Quote: ... 1% sodium bicarbonate (Lonza) and 2mM L-glutamine (Lonza) ...
-
bioRxiv - Genomics 2022Quote: ... Following 6-TG treatment 5×106 HM-1 cells were transfected using a Nucleofector®-4D (Lonza) with the P3 Primary Cell X kit ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were electroporated with enhancer (IDT, #1075915, final concentration 4 μM) in a nucleofector device (Lonza, Nucleofector 2; program D-032). Cells were incubated for 24 h to allow them to recover and then detached and cloned by serial dilution ...
-
bioRxiv - Molecular Biology 2021Quote: ... UW289.B1 was grown in 1:1 mixture of RPMI and MGEM (Lonza) with Single Quots (Lonza ...
-
bioRxiv - Biochemistry 2020Quote: ... 100 U ml−1 penicillin and 100 μg ml−1 streptoMycin sulfate (Lonza). Cells were split and/or harvested at 80-90% confluency using 0.05% Trypsin–EDTA.
-
bioRxiv - Cell Biology 2019Quote: ... 1% HEPES (Carl Roth, Karlsruhe, Germany) and 1% penicillin/streptomycin (Lonza, Basel, Switzerland) and used for analysis or grown for at least 6 d for ATI cell differentiation ...
-
bioRxiv - Immunology 2022Quote: ... at 1:1 ratio in T cell media: RPMI 1640 (Lonza #BE12-702F), 10% heat-inactivated fetal bovine serum (Gibco #10-082-147) ...
-
bioRxiv - Cell Biology 2024Quote: ... at a ratio of 1:1 in media composed of X-VIVO15 (Lonza) + 10% huABS (Valley Biomedical ...
-
bioRxiv - Cell Biology 2021Quote: ... and cells were isolated by centrifugation at 500 g for 5 min at 4°C followed by being treated with ACK Lysing Buffer (10-548E, Lonza Bioscience, Switzerland) to remove red blood cells ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were electroporated at 5 million cells/100 mL cells per cuvette using a Lonza 4-D nucleofector with pulsecode DP-148 (Lonza, VVPA-1002). Cells were co-cultured for 5 additional days with human astrocyte before transferring cells to homeostatic culture conditions (MGdM media ...