Labshake search
Citations for Lonza :
251 - 300 of 1905 citations for 3 3 2 3 Dimethyl indol 1 yl 2 hydroxy propylamino propan 1 ol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... Approximately 15,000 HMEC-1 cells/100 μl were seeded on coated wells using EGM-2 media (Lonza, Switzerland) and incubated overnight either with conditioned media from toxin-treated iPSC-MSC or vehicle at 37 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... U–2–OS-pEP15 cells (5) were maintained in 1 mg/ml glucose phenol-red-free DMEM (Lonza) supplemented with steroid-free FBS (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... All cells were used at passage 1-2 and were growth arrested in smooth muscle basal media (Lonza) supplemented with 0.3% FBS for 24-48 h before beginning experiments ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mM glutamine (Lonza) and 100 U/mL penicillin/streptomycin (Lonza) ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mM glutamine (Lonza) and 100 U/mL penicillin and streptomycin (Lonza) ...
-
bioRxiv - Bioengineering 2021Quote: ... EGM-2 medium (Lonza) was added in a 1:1 ratio to the cell suspension before a centrifugation step at 300g for 5 min ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 mM glutamine (Lonza) and 50 ng/mL RANKL (Peprotech) ...
-
A small molecule reveals role of insulin receptor-insulin like growth factor-1 receptor heterodimersbioRxiv - Cell Biology 2021Quote: ... in EGM-2 (Lonza) for 24 hrs prior to plating ...
-
bioRxiv - Immunology 2022Quote: ... 2 mM HEPES (Lonza), 100 µg/ml collagenase from Clostridium histolyticum type IV (Sigma-Aldrich ...
-
bioRxiv - Pathology 2021Quote: ... 2 mM glutamine (Lonza), and 100 U/ml Penicillin-Streptomycin (PS ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mM UltraGlutamine (Lonza) and 1% Penicillin-Streptomycin (Biowest) ...
-
bioRxiv - Cell Biology 2021Quote: ... EGM-2 medium (Lonza) supplemented with 16% defined foetal bovine serum (FBS ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... to FGM-2 (Lonza), made per manufacturer’s instructions.
-
bioRxiv - Cell Biology 2024Quote: ... 2 mM UltraGlutamine (Lonza), 100 units/mL penicillin ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 mM UltraGlutamine (Lonza), 100 units/ml penicillin and 100 µg/ml streptomycin (Sigma-Aldrich) ...
-
bioRxiv - Bioengineering 2023Quote: ... in EGM-2 (Lonza) culture medium kit ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 mM glutamine (Lonza) and P/S/A (Lonza) ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 mM glutamine (Lonza) and P/S/A (Lonza) ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 mM glutamine (Lonza), 20 µg/mL pituitary extract (Gibco) ...
-
bioRxiv - Immunology 2024Quote: ... 2 mM glutamine (Lonza), 50 U/mL penicillin ...
-
bioRxiv - Microbiology 2021Quote: ... HPMEC were cultured in endothelial cell growth basal medium 2 supplemented with an Endothelial Cell Growth Medium-2 (EGM-2™) supplemental bullet kit (Lonza). Cells were maintained at 37°C with 5% CO2 ...
-
bioRxiv - Cell Biology 2020Quote: ... were purchased from Lonza and grown in EMB-2 media supplemented with EGM-2 SingleQuot Kits (Lonza). Cells were transfected with miR-1253 Pre-miR miRNA Precursor (Assay ID #PM13220 ...
-
bioRxiv - Bioengineering 2021Quote: ... HUVECs were cultured in endothelial cell growth basal medium-2 (EBM-2; Lonza) supplemented with FBS and an EGM-2 BulletKit (Lonza ...
-
bioRxiv - Genetics 2022Quote: ... supplemented with Smooth Muscle Medium-2 SingleQuots Kit (SmGM-2, CC-4149, Lonza) (complete media) ...
-
bioRxiv - Neuroscience 2021Quote: ... 20 μg/ml fibroblast growth factor 2 (FGF-2) (Lonza, Basel-Stadt, Switzerland) and 1% (v/v ...
-
bioRxiv - Bioengineering 2022Quote: ... Cells were expanded in EGM-2 MV media (EBM-2 supplemented with Lonza’s SingleQuot supplements ...
-
bioRxiv - Bioengineering 2022Quote: ... were obtained from Thermo Fisher Scientific and cultured with EGM-2 medium (EGM™-2 BulletKit™, Lonza). Once reached 80-90% confluency ...
-
bioRxiv - Molecular Biology 2024Quote: ... and resuspended in EBM™-2 (Endothelial Cell Growth Basal Medium-2, Lonza). 500 μl EGM-2 BulletKit™ culture medium (with full supplements ...
-
bioRxiv - Bioengineering 2024Quote: ... Cells were expanded in EGM-2 MV media (EBM-2 supplemented with Lonza’s SingleQuot supplements ...
-
bioRxiv - Bioengineering 2024Quote: ... Cells were expanded in EGM-2 MV media (EBM-2 supplemented with Lonza’s SingleQuot supplements ...
-
bioRxiv - Bioengineering 2023Quote: ... containing Microvascular Endothelial Cell Growth Medium-2 SingleQuots Kit (EGM-2 MV, Lonza). Both cell lines proliferate at the permissive temperature of 33°C and maturate at 37°C.
-
bioRxiv - Immunology 2023Quote: ... were cultured in endothelial cell basal medium-2 (EBM-2: Lonza, Basel, Switzerland) supplemented with the EGM-2 MV SingleQuots kit (Lonza) ...
-
bioRxiv - Bioengineering 2023Quote: ... were cultured on dishes in Endothelial Cell Growth Medium-2 (EGM-2; Lonza). Normal human dermal fibroblasts (NHDFs ...
-
bioRxiv - Cell Biology 2024Quote: ... were cultured in EC growth medium-2 (EGM™-2 Bulletkit™; Lonza) containing growth factors or MCDB 131 (Gibco ...
-
bioRxiv - Immunology 2024Quote: ... supplemented with 10 mM N’-2-Hydroxyethylpiperazine-N’-2 ethanesulphonic acid (HEPES, Lonza), 2 mM Glutamax (Gibco) ...
-
bioRxiv - Bioengineering 2024Quote: ... were cultured in Endothelial Cell Growth Medium-2 (EGM-2) (Lonza; CC-3162) supplemented with 1% PenStrep with media changes every 2 days and passages at 1:3 ratio when confluent ...
-
bioRxiv - Genomics 2024Quote: ... supplemented with Smooth Muscle Medium-2 SingleQuots Kit (SmGM-2, CC-4149, Lonza) (complete media) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and the cell pellet was resuspended in Keratinocyte Growth Medium-2 Bullet Kit (KGM2 medium) consisting of KGM-2 Basal Medium and KGM-2 SingleQuots Supplements (Lonza, Basel, Switzerland), and then seeded onto Petri dishes coated with collagen IV ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Five milligrams of niclosamide inhalation powder was loaded into size #3 hydroxypropyl methylcellulose capsules (Vcaps® plus, Capsugel®, Lonza, Morristown, NJ, USA). The aerodynamic properties of the powder were evaluated using a Next Generation Impactor (NGI ...
-
bioRxiv - Neuroscience 2022Quote: ... Harvested EBs were transferred to a tissue-culture treated 6-well plate (Falcon, #353224) in 3 ml of EB Differentiation media: X-VIVO 15 (Lonza Biosciences, #04-418Q) + 1% Glutamax (Life Technologies ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Genomics 2020Quote: ... 1 million U2OS cells were transfected using the Nucleofector 2b with 2 μg Plasmid DNA using kit V (Lonza) according the manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2021Quote: ... 2 × 105 organoid single cells were re-suspended with Lonza P3 nucleofection buffer and 1 µl of pmaxGFP (Lonza) and transferred to 20 µl nucleofection cuvette (V4XP-3024 ...
-
bioRxiv - Immunology 2020Quote: ... Colons were incubated 2 times at 200 rpm in 40 mL HBSS + 0.1% BSA + 1% Penicillin-Streptomycin (PS, Lonza) + 5mM EDTA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... and maintained in endothelial cell medium-2 (EGM-2 - Clonetics, Lonza, Walkersville, MD, USA) supplemented with endothelial growth medium (EGM ...
-
bioRxiv - Cell Biology 2020Quote: ... grown in endothelial basal cell medium 2 supplemented with EGM-2 Singlequot supplements (Lonza). HUVECs maintained at 37°C in a humidified atmosphere of 5% CO2 and used between passages 1-5 ...
-
bioRxiv - Systems Biology 2021Quote: ... TIME cells were cultured in Endothelial Cell Growth Medium-2 BulletKitTM (EGM-2, Lonza). All cell cultures utilized in this study were maintained at 5% CO2 atmosphere and 37°C.
-
bioRxiv - Bioengineering 2022Quote: ... supplemented with EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (Lonza, USA). HUVECs were used between passages 3– 6 ...
-
bioRxiv - Bioengineering 2022Quote: ... and supplemented with an Endothelial Growth Media-2 (EGM-2) SingleQuots Kit (Lonza, MD). Since liver sinusoid ECs results in higher (7.13 fold higher ...