Labshake search
Citations for Lonza :
2601 - 2650 of 2967 citations for Rat Insulin Like Growth Factor 2 IGF2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: The absence of Mycoplasma in the cell lines was routinely controlled using the MycoAlert mycoplasma detection kit (Lonza, LT07-318).
-
bioRxiv - Genomics 2024Quote: Transfections of DNA constructs in ESCs were performed using the P3 Primary Cell 4D-Nucleofector X Kit (V4XP-3024) and the Amaxa 4D Nucleofector system (Lonza). For each nucleofection ...
-
bioRxiv - Microbiology 2024Quote: Raw264.7 CRISPR cells were generated by electroporation of low passage Raw264.7 cells with Dhx58 and Ifih1 pSBtet-puro-Cas9-U6 using Amaxa Nucleofector II and Amaxa Cell Line Nucleofector Kit V (Lonza). Cells were selected with puromycin 3 days post-nucleofection ...
-
bioRxiv - Cell Biology 2023Quote: ... and Cas9-GFP were then transfected into human iPSCs for INS mutation correction using embryonic stem cell Nucleofector Kit (VVPH-5012, Lonza). Transfected cells were cultivated in StemFlex medium (catalog #A3349401 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The absence of mycoplasma contamination in cell cultures was frequently validated using the MycoAlert Mycoplasma Detection Kit (Lonza, NY, USA).
-
bioRxiv - Immunology 2024Quote: ... Plasmids were sequenced at the OHSU sequencing core and transfected into BEAS-2B MR1-/- cells using the Amaxa nucleofection system with Kit T solution (Lonza). The transfection efficiency was evaluated via GFP expression by flow cytometry (Supplementary Figure 4) ...
-
bioRxiv - Immunology 2024Quote: ... were nucleofected into 1e6 BEAS-2B WT cells at 300 nM according to the manufacturer’s instructions (Lonza, Nucleofector Kit T). Cells were allowed to rest overnight (TAPBPR and tapasin ...
-
bioRxiv - Cancer Biology 2023Quote: ... twice and resuspended in Cell Line Nucleofector solution SF (16.4uL) with Supplement (3.6uL) (SF Cell Line 4D-nucleofector X Kit, Lonza, V4XC-2032). Alt-R SpCas9 nuclease (100pmol ...
-
bioRxiv - Neuroscience 2023Quote: Transfection of dissociated neurons was performed using the AMAXA Nucleofector system (program O.005) with the mouse neuron Nucleofector kit (Lonza) following the manufacturer’s specifications ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were resuspended in 90 µL of nucleofection solution (16.2 µL of Supplement solution mixed with 73.8 µL of SF solution from SF Cell Line 4D-Nucleofector™ X Kit L) (Lonza), transferred to the 15 µL RNP solution ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cells were resuspended in respective electroporation/nucleofection buffer (HEK293T cells and HepG2 SF Buffer (SF Cell Line 4D-Nucleofector X Kit, Lonza), Jurkat cells SE buffer (SE Cell Line 4D-Nucleofector X Kit ...
-
bioRxiv - Microbiology 2023Quote: Constructed plasmids encoding AS1-S were introduced into MDBK cells using Amaxa cell line Nucleofector kit R (Lonza, Kanagawa, Japan) with Amaxa Nucleofector II system in accordance with the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Knock-down procedures were performed with siRNA purchased from Riboxx (non-targeting siRNA: UUGUACUACACAAAAGUACCCCC; US10 targeting #1: UUCUGAAUAACACAGCCGCCCCC) applying the SE Cell Line Kit (Lonza) for fibroblasts and Lipofectamine RNAiMax (Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... isolated WT P14 CD8+ T cells were washed with PBS and mixed with RNPs by using P3 Primary Cell 4D-NucleofectorTM X Kit (Lonza) immediately prior to electroporation (Lonza 4D-nucleofactorTM core unit ...
-
bioRxiv - Neuroscience 2023Quote: ... 01F49i-N-B7 iPSCs were dissociated to single cells and 250,000 cells transfected with 25 μL of the prepared transfection mix containing 20 µL of nucleofection buffer (P3 Primary Cell 4D-NucleofectorTM X Kit S, Lonza), 5 µL of the RNP complex ...
-
bioRxiv - Immunology 2023Quote: CRISPR–Cas9 gene knockout was performed by transient Cas9/gRNA (RNP) complex electroporation using the P3 Primary Cell 4D-Nucleofector X Kit S (Lonza). On day 4 of culture ...
-
bioRxiv - Genomics 2023Quote: ... 2.5e5 RPE1 CRISPRi cells were nucleofected with 3μM RNP complex using an SE Cell Line 4D X Kit S (Lonza Bioscience) on a 4D-Nucleofector (Lonza Bioscience ...
-
bioRxiv - Genomics 2023Quote: ... Neurons were nucleofected with 10 µ total DNA plasmid DNA using the AD1 4D-Nucleofector Y kit (Lonza V4YP-1A24) with the ED158 (iCell GlutaNeurons ...
-
bioRxiv - Cell Biology 2023Quote: ... T cells were washed with PBS and resuspended at 100x106 cells/mL in Lonza P3 Primary Cell 4D Nucleofector Kit buffer (Lonza). 1μg/1x106 cells of sgRNA (Agilent ...
-
bioRxiv - Genetics 2023Quote: ... and cells were resuspended according to the protocol provided for the P3 Primary Cell 4D-Nucleofector Kit (Lonza, V4XP-3024). Briefly ...
-
bioRxiv - Cancer Biology 2023Quote: ... All cell lines were routinely tested for mycoplasma contamination using a MycoAlert PLUS Mycoplasma Detection Kit (#LT07-710, Lonza, Switzerland).
-
bioRxiv - Cancer Biology 2023Quote: ... The dissociated GSCs (1 × 106 cells) were resuspended in 100 μl of supplemented solution of the Human Stem Cell Nucleofector Kit 1 (Lonza) containing a combination of the px458 plasmid targeting each gene and the ssODN and then electroporated using B-016 program of Nucleofector 2b (Lonza) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5-6 million primary human keratinocytes were electroporated with 1 nmol siPools using the Amaxa human keratinocyte Nucleofector kit (Lonza) according to the manufacturer’s instructions and the T-018 program of the Amaxa Nucleofector II device (Lonza) ...
-
bioRxiv - Microbiology 2023Quote: ... The genotypic identity of the parasites (28) and the absence of Mycoplasma contamination using the MycoAlert Mycoplasma Detection Kit (Lonza) were verified regularly ...
-
bioRxiv - Cancer Biology 2023Quote: Cas9-RNPs were transfected into cells by electroporation (SF Cell Line 4D-Nucleofector™ X Kit S (Lonza, #V4XC-2032)) ...
-
bioRxiv - Microbiology 2023Quote: ... Ribonucleoproteins were introduced into 1 x 106 sub-confluent BLaER1 cells using 4D-Nucleofector X Unit and SF Cell line Kit (Lonza), applying program DN-100 ...
-
bioRxiv - Molecular Biology 2023Quote: Transfections of K562 cells were performed using a Lonza Bioscience 4D-Nucleofector system and the SF Cell Line 4D-Nucleofector X kits (Lonza). For single nucleocuvettes (100 uL) ...
-
bioRxiv - Microbiology 2023Quote: ... amazonensis promastigotes using the Human T-Cell Nucleofector kit and the Amaxa Nucleofector electroporator (program U-033, Lonza, Basel, Switzerland), for integration into the 18S rRNA locus within the nuclear DNA ...
-
bioRxiv - Cell Biology 2023Quote: ... and 2000 p mol of a degron-tagged control protein (mTagBFP2-RxxG) in a 100 µl nucleofection reaction (4D nucleofector kit SE plus supplement SF1, Lonza) 14 hours following nucleofection ...
-
Efficient Methods for Target Gene Manipulation in Haematopoietic Stem Cell Derived Human NeutrophilsbioRxiv - Cell Biology 2023Quote: ... CD34+ HSPC selected as previously described were preconditioned in SFEM II and StemSpan cytokines for 72 hours and electroporated with the Cas9-gRNP mixture using the Human CD34+ Cell Nucleofector kit (Lonza) in a Lonza IIb Nucleofector using program U-008 ...
-
bioRxiv - Neuroscience 2023Quote: ... before being introduced to the KOLF2 hiPSCs through electroporation (P3 Primary Cell 4D-Nucleofector X Kit, Program CA-137, Lonza). The resulting clones were screened by multiplexed amplicon sequencing on an Illumina Mi-Seq platform with the MiSeq Reagent Kit V2 (Illumina) ...
-
bioRxiv - Cancer Biology 2022Quote: ... The cell lines were authenticated and regularly tested for Mycoplasma using the MycoAlert PLUS detection kit by Lonza (LT07-710).
-
bioRxiv - Bioengineering 2023Quote: Approximately 0.25 × 106 U2OS.eGFP-PEST cells were nucleofected with 300 ng of Cas9 expression plasmid and 30 ng of eGFP-targeting gRNA expression plasmid using the SE Cell line 4D-Nucleofector X Kit (Lonza) and DN100 pulse program ...
-
bioRxiv - Bioengineering 2023Quote: ... and 50 ng of AcrIIA4 expression or 300 ng of Cas9-P2A-CSD-AcrIIIA4 plasmid and 30 ng eGFP-targeting gRNA expression plasmid using the SE Cell line 4D-Nucleofector X Kit (Lonza) and DN100 pulse program ...
-
bioRxiv - Cancer Biology 2023Quote: All cell lines used are of human origin and were confirmed negative for mycoplasma before experimental use by using the MycoAlert Mycoplasma Detection Kit (Lonza) according to the manufacturer’s specifications.
-
bioRxiv - Cell Biology 2023Quote: Differentiated HL-60 cells were nucleofected with Amaxa Nucleofector II device and Amaxa Cell line kit V (Lonza, VACA-1003) and prepared for live-cell imaging using aslightly modified version of an existing protocol 96 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Two gRNA plasmids and pCas9 (D10)-GFP plasmid were nucleofected into cells using Basic Nucleofector Kit for Primary Mammalian Epithelial Cells (Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... were delivered as a ribonucleoprotein complex with the DNA donor template using a Nucleofector 2b Device and the Human Stem Cell Nucleofector Kit 1 (Lonza) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... All cell lines were authenticated by Multiplex Cell Line Authentication (MCA) and were tested for mycoplasma by MycoAlert Mycoplasma Detection Kit (Lonza). U2OS cells were transfected with the plasmids using Lipofectamine 2000 and according to the manufacturer’s instructions (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were nucleofected with 4 µg of the sgRNA-containing plasmid individually following the Amaxa Mouse ES cell Nucleofector kit recommendations (VPH-1001, Lonza). Later ...
-
bioRxiv - Genetics 2023Quote: LCLs were treated with 2nM Retinoic acid for 24 hours prior to transfection of firefly and renilla luciferase constructs by Amaxa Nucleofector kit V (Lonza) with the X001 program on a Nucleofector II device ...
-
bioRxiv - Cell Biology 2023Quote: ... The cell lines used in this study were routinely tested for mycoplasma contamination using MycoAlert Mycoplasma Detection Kit (#LT07-318, Lonza), and mycoplasma-negative cells were used ...
-
bioRxiv - Cell Biology 2023Quote: ... hESCs were nucleofected with RNPs using the 4D-Nucleofector and P3 Primary Cell 4D-Nucleofector X Kit and program CB150 (Lonza). After 24□hours ...
-
bioRxiv - Developmental Biology 2023Quote: ... and co-transfected with an ssODN donor template containing the desired modification into H9/WA09 cells via nucleofection (Amaxa P3 primary cell 4D nucleofector X kit L, Lonza) using the manufacturer’s recommended protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... The cell pellet was used for nucleofection using the P3 Primary Cell 4D-Nucleofector X Kit L (Lonza, V4XP-3024), a 4D-nucleofector core unit and X unit (Lonza ...
-
bioRxiv - Cell Biology 2024Quote: ... serum-starved RPE1 cells where trypsinized and 0.5×106 of the cells were resuspended in 20 μl of the P3 Primary Cell 4D-Nucleofector Kit buffer (Lonza). The cell suspension was then nucleoporated with reporter plasmids with DNA lesions and undamaged control plasmids ...
-
bioRxiv - Cancer Biology 2024Quote: ... and delivered to parental K562 cells by Amaxa nucleofection using the Amaxa Cell line nucleofector kit V (Lonza VCA-1003). GFP+ transfected cells were single-cell sorted into 96-well plates ...
-
bioRxiv - Systems Biology 2024Quote: The reporter cell line for the PTGR screen was created by nucleofection of haploid AN3-12 mESCs with 500ng of the reporter construct and 10 µg of a Tol2 transposase encoding plasmid using the Mouse ES Cell Nucleofector Kit (Lonza) according to the manufacturer’s protocol using an Amaxa Nucleofector (Lonza) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... negative selection of T cells was performed using the EasySep human T cell isolation kit (Stemcell) and cultured in X-VIVO 15 medium (Lonza) supplemented with 5% fetal bovine serum (FBS) ...
-
bioRxiv - Genomics 2023Quote: ... All cell lines were authenticated by short tandem repeat (STR) profiling and verified mycoplasma free using the MycoAlert PLUS Mycoplasma Detection kit (Lonza) prior to conducting experiments ...