Labshake search
Citations for Lonza :
201 - 250 of 1776 citations for Streptavidin ZAP Antibody Kit rat since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... Mycoplasma screening was performed using a MycoAlert detection kit (Lonza). Cell lines were maintained at 37°C and 5% CO2 ...
-
bioRxiv - Developmental Biology 2019Quote: ... cells were kept in HCM medium (HCM Bullet Kit, Lonza) supplemented with “singlequots” supplied with the kit (except for the EGF ...
-
bioRxiv - Cancer Biology 2020Quote: ... as screened with the MycoAlert® Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... using the MycoAlert PLUS assay kit from Lonza (Basel, Switzerland), and were authenticated by short tandem repeat profiling.
-
bioRxiv - Neuroscience 2021Quote: ... 4D-Nucleofector™ unit X Kit (program CA-137; Lonza) was used according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... Cultures were tested for mycoplasma using a MycoAlert Kit (Lonza), and for bacteria ...
-
bioRxiv - Bioengineering 2022Quote: ... 5% CO2 in EGM-2 Bullet Kit (Lonza CC-3162) medium and used between passages 4-8.
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were screened for mycoplasma with MycoAlert detection kit (Lonza) at receipt or thaw ...
-
bioRxiv - Bioengineering 2024Quote: ... were cultured in a supplemented (EGM-2 bullet kit, Lonza) endothelial cell growth medium (Lifeline Cell Technology ...
-
An endothelial SOX18-mevalonate pathway axis enables repurposing of statins for infantile hemangiomabioRxiv - Molecular Biology 2024Quote: ... and supplemented with EGM-2 bullet kit (Lonza, CC-3162). HUVEC were seeded on 0.5% gelatin-coated 6-well plates at a density of 1.5 x105 cells/well overnight ...
-
bioRxiv - Immunology 2024Quote: ... were nucleofected using P3 Primary cell 4D-nucleofection kit (Lonza) and DN100 pulse on 4D nucleofector X unit (Lonza) ...
-
bioRxiv - Cell Biology 2024Quote: ... in combination with the P3 Primary Cell Buffer Kit (Lonza). Per sample ...
-
bioRxiv - Genetics 2024Quote: ... and SF Cell Line 4D X Kit (Lonza, #V4XC-2024) were employed ...
-
bioRxiv - Cell Biology 2024Quote: ... and the Cell line Nucleofector Kit T (Lonza, VCA-1002) were used for the plasmids cells transfections (1-5 µg) ...
-
bioRxiv - Bioengineering 2023Quote: ... and Amaxa Human CD34+ Cell Nucleofector kit (Lonza, Basel, Switzerland) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... Nucleofection was performed using the Amaxa MEF2 Nucleofector Kit (Lonza) following the manufacturer’s suggested protocol ...
-
Chromatin priming elements direct tissue-specific gene activity prior to hematopoietic specificationbioRxiv - Genomics 2023Quote: ... with the P3 Primary Cell X kit (Lonza, V4XP-3024). ES cells clones were picked and screened for successful homologus CRISPR by PCR using primers designed outside of the CRISPR guide region (AAGGCTGTCTAGCACTCGTT ...
-
bioRxiv - Neuroscience 2023Quote: ... using the P3 Primary Cell nucleofector kit (Lonza, V4XP-3012). 8×105 cells were resuspended in 100µl P3 solution ...
-
bioRxiv - Biochemistry 2023Quote: ... Using Amaxa SF Cell Line 4D-Nucleofector X Kit (Lonza), WT HEK293T cells were transfected with a transposase-encoding plasmid (pSB100X) ...
-
bioRxiv - Biochemistry 2022Quote: ... Cultures were tested regularly with MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Bioengineering 2023Quote: ... SE and P3 Cell Line 4D-Nucleofector X Kit (Lonza) was used as the nucleofection agent following the manufacturer’s protocol ...
-
Cancer-associated fibroblasts produce matrix-bound vesicles that influence endothelial cell functionbioRxiv - Cancer Biology 2023Quote: Transient knockdown was performed using the Amaxa kit R (Lonza) and Nucleofector device (program T-20 ...
-
bioRxiv - Cell Biology 2023Quote: Nucleofection was performed using the Amaxa MEF2 Nucleofector Kit (Lonza) following the manufecturer’s suggested protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... and gentamicin/amphotericin (Single Quots® kit, CC‒4127, Lonza), pH 7.40 ...
-
bioRxiv - Immunology 2023Quote: ... using a mouse T cell nucleofection kit (Lonza, VPA-1006), and rested overnight in R10 medium ...
-
bioRxiv - Molecular Biology 2023Quote: ... With the mouse ES Cell Nucleofector Kit (Lonza VPH-1001), PiggyBAC and pBASE plasmid are co-transfected into mESCs ...
-
bioRxiv - Cancer Biology 2024Quote: ... and were screened for mycoplasma (MycoAlert kit, Lonza, Basel, Switzerland). HCI-10 PDX tumor fragments were provided by Dr ...
-
bioRxiv - Cell Biology 2024Quote: ... and Amaxa P3 Primary Cell kit L (Lonza, V4XP-3012), program CB-150 ...
-
bioRxiv - Systems Biology 2024Quote: ... and Mouse Embryonic Stem Cell NucleofectorTM Kit (#VPH-1001, Lonza). Three biological replicates were performed per library on different days ...
-
bioRxiv - Cancer Biology 2024Quote: ... UWB1.289PT in the 50% RPMI-1640 (Gibco™)/ 50% MEGM (MEGM Bullet Kit; CC-3150, Lonza, Basel, Switzerland) supplemented with 3% FBS ...
-
bioRxiv - Biochemistry 2024Quote: ... Mycoplasma testing was conducted using the MycoAlert Detection Kit (Lonza). Cells were cryopreserved using complete growth media containing 5% (v/v ...
-
bioRxiv - Cancer Biology 2024Quote: ... using the SE Cell Line 4D Nucleofector X Kit (Lonza) and program EN-104 was used for nucleofection ...
-
bioRxiv - Cancer Biology 2023Quote: ... The antibody supernatant passed through a 0.22-µm filter and neutralized with 10XPBS buffer (Lonza™ BioWhittaker™ Phosphate Buffered Saline (10X) ...
-
bioRxiv - Cell Biology 2022Quote: ... the cell pellet was re-suspended in antibody medium (EGM2 CC-3162, Lonza, Basel, Switzerland) with anti-mouse CD31 (PECAM1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... the cell pellet was re-suspended in antibody medium (EGM2 CC-3162, Lonza, Basel, Switzerland) with anti-mouse CD31 PE antibody (1:400 ...
-
bioRxiv - Cell Biology 2020Quote: ... using the Amaxa P3 Primary Cell 4D-Nucleofector X Kit (Lonza) on a 4D Nucleofector device (Lonza) ...
-
bioRxiv - Cell Biology 2020Quote: ... with the Amaxa P3 Primary Cell 4D Nucleofector X Kit (Lonza) according to the manufacturer’s instructions.
-
bioRxiv - Genetics 2021Quote: ... and Mouse Embryonic Stem Cell Nucleofector™ Kit (#VPH-1001, Lonza). Klf2 and Nanog loci Upstream assay libraries were mixed and transfected together ...
-
bioRxiv - Genomics 2021Quote: ... supplemented with BEGM Bronchial Epithelial SingleQuots Kit (excluding GA-1000, Lonza), 10% fetal bovine serum ...
-
bioRxiv - Immunology 2021Quote: ... and SE Cell Line 4D Nucleofector X kit (Lonza, Basel, Switzerland). Each cuvette had 4 μg of DNA and 107 CHOZN cells concentrated in SE cell solution ...
-
bioRxiv - Developmental Biology 2020Quote: ... Cell lines were monthly checked for Mycoplasma contaminations (LONZA – MYCOALERT KIT), and all samples analyzed in this study were not contaminated ...
-
bioRxiv - Molecular Biology 2020Quote: ... using an Amaxa Nucleofector 2b device and ES nucleofection kit (Lonza) per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... Transient siRNA transfections were performed using Amaxa kits C (Amaxa Lonza) for CEM.NKR-CCR5 cells ...
-
bioRxiv - Microbiology 2019Quote: ... and the P3 Primary cell 4D Nucleofector X Kit L (Lonza)(20) ...
-
bioRxiv - Microbiology 2021Quote: ... and Vero cells were tested for mycoplasma (Lonza MycoAlert detection kit) and human cell line identity was authenticated by ATCC ...
-
bioRxiv - Neuroscience 2020Quote: ... France) by nucleofection using the AMAXA Mouse Neuron Nucleofector Kit (Lonza). Each transfection was performed with 1.5 × 106 hippocampal neurons and plated on three video microscopy dishes (ibidi).
-
bioRxiv - Biochemistry 2020Quote: ... Cells are monthly checked for mycoplasma contamination (MycoAlert detection kit, Lonza).
-
bioRxiv - Microbiology 2020Quote: ... Cells were tested monthly for mycoplasma MycoAlert Mycoplasma detection kit (Lonza) and treated with Mycoplasma Removal Agent (MP Biomedical ...
-
bioRxiv - Cell Biology 2021Quote: ... or Amaxa cell line nucleofection kit V (Lonza, Cat#VCA-1003).
-
bioRxiv - Microbiology 2021Quote: ... HT1080 cells were transfected using Amaxa Nucleofector Kit T (Lonza #VCA1003). For each transfection ...