Labshake search
Citations for Lonza :
201 - 250 of 1676 citations for Rat Toll Interacting Protein TOLLIP ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... with an Amaxa Mouse Dendritic Cell Nucleofection Kit (Lonza). The abovementioned pIRES2-AcGFP1-series plasmids were used for transient expression ...
-
bioRxiv - Biochemistry 2019Quote: ... Sf21 cells (2 × 106 cells mL−1) were infected with the P3 viral stock in Insect-XPRESS protein-free medium (Lonza). The infected insect cells were grown at 27 °C with shaking for 66 hours ...
-
bioRxiv - Microbiology 2020Quote: ... major promastigotes expressing Cas9 and T7 RNA polymerase proteins [30] were co-transfected with donor DNA and sgRNA templates using V-033 program of Amaxa Nucleofector System (Lonza). Transfected parasites were selected with 50 μg/ml neomycin and cloned in semi-solid culture medium ...
-
bioRxiv - Microbiology 2020Quote: ... cells were transfected with pcDNA3 HA eIF4GI plasmid or control green fluorescent protein (GFP)-expressing plasmid (pMAX-GFP plasmid, Lonza). pcDNA3 HA eIF4GI (1–1599 ...
-
bioRxiv - Bioengineering 2021Quote: Primary human umbilical vein endothelial cells (HUVECs) and red fluorescent protein-expressing HUVECs (RFP-HUVECs) were maintained in EMG-2 medium (complete EGM-2 BulletKitTM, Lonza). We obtained human umbilical cords from Xinhua Hospital Affiliated to Shanghai Jiaotong University School of Medicine ...
-
bioRxiv - Cell Biology 2020Quote: ... The purity of CyaA batches is higher than 90% as judged by SDS PAGE analysis and contained less than 1 EU of LPS/μg of protein as determined by a standard LAL assay (Lonza). Finally ...
-
bioRxiv - Cell Biology 2021Quote: ... Western blots were conducted by running equivalent amounts of protein on 4-20% Tris-Glycine SDS/polyacrylamide gradient gels (Lonza) after reduction with 2-mercaptoethanol and heating to 95°C for 5m ...
-
bioRxiv - Immunology 2021Quote: ... for RNP formation 180 pmol crRNA-tracrRNA duplex was mixed with 60 pmol Cas9 protein in Nucleofection Buffer P3 (Lonza) and incubated for at least 10 min at room temperature ...
-
bioRxiv - Developmental Biology 2022Quote: ... This cocktail was provided to the cells together with a ribonucleoprotein complex consisting of crRNA, tracrRNA and Cas9 protein (IDT, refer to “Oligonucleotides” for crRNA sequence) via nucleofection using a 4D nucleofector (Lonza). Next ...
-
bioRxiv - Molecular Biology 2023Quote: ... complexes for each peak to be deleted were prepared individually by mixing 120 pmol of sgRNA with 20 pmol of Cas9 protein (QB3 MacroLab, University of California, Berkeley) in 5 ul of P3 primary cell nucleofection buffer (Lonza) and incubated at room temperature for 15 minutes ...
-
bioRxiv - Physiology 2023Quote: ... 2 μl of KCNQ2/3 cDNA plasmid (0.9 g/l) and 1 μl of pmax green fluorescent protein vector (0.5 g/l) (Lonza, Cologne, Germany) were diluted in 125 μl of Opti-MEM medium (Life Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: ... 1.5-2.0 x 105 cells were electroporated with 200 pmol of protein in 20 µl cuvettes using a 4D nucleofector device (Lonza) according to the manufacturer’s recommendations ...
-
bioRxiv - Biochemistry 2023Quote: ... Sf21 cells seeded at 500,000 cells/mL were transfected with recombinant bacmid DNA to generate the initial baculovirus (P1) in Insect-XPRESSTM Protein-free Insect Cell Medium (Lonza). The P1 virus was amplified two times (P2 and P3 ...
-
bioRxiv - Immunology 2024Quote: ... The reaction contained 400 pmol of Cas9 protein and 1 × 107 of the transduced NK cells in 100 µL of P3 solution (Lonza). Immediately after electroporation ...
-
bioRxiv - Pathology 2020Quote: ... The purity of the final recombinant proteins was determined to be more than 99% by sodium dodecyl sulfate and polyacrylamide gel (SDS-PAGE) with an endotoxin concentration lower than 2 units/mg protein measured by Limulus Amebocyte Lysate PYROGENT™ 125 Plus (Lonza). In previous experiments we demonstrated that these recombinant proteins were functionally devoid of significant endotoxin contamination ...
-
bioRxiv - Immunology 2020Quote: ... Six micrograms of plasmid DNA encoding the cDNA of the desired proteins was used for a single transfection reaction using program T-019 on the Amaxa Nucleofector II (Lonza, MD).
-
bioRxiv - Cancer Biology 2022Quote: ... Cell lines were periodically tested for mycoplasma using the EZ-PCR™ Mycoplasma Detection Kit (Biological Industries, Cromwell, CT, USA) and the MycoAlert™ Mycoplasma Detection Kit (Lonza, Basal, Switzerland) and were confirmed to be mycoplasma free ...
-
bioRxiv - Cancer Biology 2021Quote: ... using buffer R (Amaxa Nucleofector Kit R VCA-1003; Lonza) and program R-001 ...
-
bioRxiv - Cell Biology 2020Quote: ... siRNA delivery was performed using either Nucleofector Kit V (Lonza) or Neon transfection system (Life Technologies ...
-
bioRxiv - Immunology 2021Quote: ... contamination with the MycoAlert Mycoplasma Detection kit (Lonza LT-07). Cell lines were not authenticated.
-
bioRxiv - Neuroscience 2020Quote: The adenylate kinase assay (ToxiLightTM bioassay kit LT07-217 Lonza) to assess toxicity was performed following the instructions of the manufacturer ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4 days after nucleofection with the AMAXA Nucleofector Kit (Lonza), we applied puromycin selection until we observed the appearance of green colonies ...
-
bioRxiv - Cell Biology 2019Quote: ... MCF 10A cells were cultured in the MEGM kit (Lonza) at 37°C with 5% CO2 ...
-
bioRxiv - Bioengineering 2020Quote: ... with a 20 μl P3 solution kit (Lonza, #V4XP-3032) with 600k PGP1 WT cells in each 20 μl reaction well as per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... Mycoplasma contamination was tested using MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Immunology 2021Quote: ... Cells were transfected using the Amaxa HUVEC Nucleofector kit (Lonza) according to the manufacturer’s protocol (2-5 µg plasmid DNA ...
-
bioRxiv - Bioengineering 2020Quote: ... supplemented with EGM Endothelial Cell Growth Medium SingleQuots Kit (Lonza) and used at passage 3-6 ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were suspended in EGM Media with Bullet Kit (Lonza) supplemented with 1μM Chiron ...
-
bioRxiv - Neuroscience 2021Quote: ... using an Amaxa Mouse Neuron Nucleofector kit (Lonza, VPG-1001) as described previously (Wuttke et al. ...
-
bioRxiv - Cancer Biology 2021Quote: ... supplemented with recommended growth supplement kit (EGM-2MV BulletKit, Lonza). Mouse mammary carcinoma cell line 4T1-luc-red (generously given by the Cross laboratory at University of Virginia ...
-
bioRxiv - Cell Biology 2021Quote: ... using the Amaxa human keratinocyte Nucleofector kit (Lonza, #VPD-1002) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... fibroblasts were transfected by nucleofection (Kit V4XP-2024, Lonza, Switzerland) with the gene drive plasmid ...
-
bioRxiv - Microbiology 2019Quote: ... and using the Amaxa human CD34+ cells Nucleofection Kit (Lonza), following the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2021Quote: ... from the P3 Primary Cell 96-well Nuclofector kit (Lonza). 3 µL of the assembled Cas9 RNPs were added to the cells ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mycoplasma testing using the MycoAlert detection kit (Lonza, Ben OR) was performed every 2 months ...
-
bioRxiv - Immunology 2022Quote: ... Cells were nucleofected using Cell Line Nucleofector Kit V (Lonza) for cell lines and P3 Primary Cell 4D-Nucleofector X Kit L (Lonza ...
-
bioRxiv - Bioengineering 2022Quote: ... were cultured in a supplemented (EGM-2 bullet kit, LONZA) endothelial cell growth medium (Lifeline Cell Technology ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mycoplasma infection monitoring was performed using MycoAlert Detection Kit (Lonza) and only mycoplasma-free cultures were used.
-
bioRxiv - Cancer Biology 2021Quote: ... based on routine testing with MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Bioengineering 2021Quote: ... tested for mycoplasma contamination using the MycoAlert Microplasma Kit (Lonza), and cultured with 0.2-micron filtered DMEM media (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mycoplasma screening was performed using a MycoAlert detection kit (Lonza). Cell lines were maintained at 37°C and 5% CO2 ...
-
bioRxiv - Developmental Biology 2019Quote: ... cells were kept in HCM medium (HCM Bullet Kit, Lonza) supplemented with “singlequots” supplied with the kit (except for the EGF ...
-
bioRxiv - Cancer Biology 2020Quote: ... as screened with the MycoAlert® Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... using the MycoAlert PLUS assay kit from Lonza (Basel, Switzerland), and were authenticated by short tandem repeat profiling.
-
bioRxiv - Neuroscience 2021Quote: ... 4D-Nucleofector™ unit X Kit (program CA-137; Lonza) was used according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... Cultures were tested for mycoplasma using a MycoAlert Kit (Lonza), and for bacteria ...
-
bioRxiv - Bioengineering 2022Quote: ... 5% CO2 in EGM-2 Bullet Kit (Lonza CC-3162) medium and used between passages 4-8.
-
bioRxiv - Cell Biology 2023Quote: ... Nucleofection was performed using the Amaxa MEF2 Nucleofector Kit (Lonza) following the manufacturer’s suggested protocol ...
-
Chromatin priming elements direct tissue-specific gene activity prior to hematopoietic specificationbioRxiv - Genomics 2023Quote: ... with the P3 Primary Cell X kit (Lonza, V4XP-3024). ES cells clones were picked and screened for successful homologus CRISPR by PCR using primers designed outside of the CRISPR guide region (AAGGCTGTCTAGCACTCGTT ...
-
bioRxiv - Neuroscience 2023Quote: ... using the P3 Primary Cell nucleofector kit (Lonza, V4XP-3012). 8×105 cells were resuspended in 100µl P3 solution ...