Labshake search
Citations for Lonza :
201 - 250 of 857 citations for 6 Methyl 4 5 6 7 tetrahydrobenzo b thiophene 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... 0.1 mM nonessential amino acids (Lonza, BW13114E), 0.005 mg/mL insulin (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... 0.1 mM non-essential amino acids (Lonza), 1 mM sodium pyruvate (Life technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1% non-essential amino acids (Lonza) at 37 °C in a 5% CO2 humidified environment.
-
bioRxiv - Immunology 2023Quote: ... Cells were harvested on day 7 with 1X PBS EDTA (Lonza).
-
bioRxiv - Genomics 2020Quote: ... Human umbilical vein endothelial cells were isolated from umbilical cords of healthy donors after cesarean sections (HUVECS; n = 4; RWTH Aachen) (55) or obtained from Lonza (n = 3, Basel, Switzerland) (8) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Systems Biology 2019Quote: ... and 1% penicillin-streptomycin-amphotericin B solution (Lonza, Walkersville, MD, USA). Cells were grown on Matrigel (BD Biosciences ...
-
bioRxiv - Bioengineering 2021Quote: ... All media contained 1% Penicillin-Streptomycin-Amphotericin B mixture (Lonza, Switzerland) as well ...
-
bioRxiv - Cell Biology 2021Quote: ... 1% NEAA and 1x Pen/Strep Amphotericin B (Lonza, 17-745E). For feeder-free culture ...
-
bioRxiv - Biophysics 2022Quote: ... 1 ml Penicillin-Streptomycin-Amphotericin B Mixture (PSF, Lonza 17-745E)) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 10% FBS and Gentamicin/Amphotericin B (FGM-2, singlequots, Clonetics/Lonza); cells were divided before reaching 80% confluency ...
-
bioRxiv - Immunology 2022Quote: ... B cells were cultured with RPMI-1640 medium (Lonza, Basel, Switzerland) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2021Quote: ... and cells were isolated by centrifugation at 500 g for 5 min at 4°C followed by being treated with ACK Lysing Buffer (10-548E, Lonza Bioscience, Switzerland) to remove red blood cells ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were electroporated at 5 million cells/100 mL cells per cuvette using a Lonza 4-D nucleofector with pulsecode DP-148 (Lonza, VVPA-1002). Cells were co-cultured for 5 additional days with human astrocyte before transferring cells to homeostatic culture conditions (MGdM media ...
-
bioRxiv - Cell Biology 2022Quote: COS-7 and U2OS cells were grown in DMEM (Lonza, 12-604F) supplemented with 10% fetal calf serum (FCS ...
-
bioRxiv - Bioengineering 2019Quote: ... MCF-7 cells were cultured in DMEM low glucose medium (Lonza, USA) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2021Quote: ... Cells were harvested on day 7 with 1 X PBS EDTA (Lonza).
-
bioRxiv - Genomics 2020Quote: ... and 1% non-essential amino acid solution (Lonza) at 37°C in a humidified atmosphere containing 5% CO2 ...
-
bioRxiv - Immunology 2021Quote: ... 1% non-essential amino acids (Lonza BE13-114E), 0.2 mM myoinositol (Sigma I7508) ...
-
bioRxiv - Neuroscience 2020Quote: ... non-essential amino acids 2 % (Lonza, Bäle, Switzerland), FGF 1 ng/mL (PeproTech ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.1 mM not essential amino acids (Lonza, BE13114E) and 100 U/ml Penicillin and Streptomycin (Euroclone ...
-
bioRxiv - Microbiology 2023Quote: ... and 1X Non-essential Amino Acids (NEAA, Lonza) (complete DMEM) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 0.1 mM non-essential amino acid solution (Lonza), and 1 mM sodium pyruvate (Lonza).
-
bioRxiv - Genomics 2019Quote: ... HAFTL pre-B cells were cultured in RPMI1640 without phenol red (Lonza) supplemented with 10% charcoal/dextran-treated FBS (Hyclone ...
-
bioRxiv - Physiology 2019Quote: ... 50 ng.mL−1 amphotericin B and 10 μg.ml−1 heparin (BulletKitTM, Lonza). Experiments were performed on cells from passage 2-5 ...
-
bioRxiv - Developmental Biology 2020Quote: ... amphotericin B (50 ng/ml) epidermal growth factor (10 ng/ml) (Lonza) and 10% Fetal Bovine serum (FBS ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293T cells and COS-7 cells (ATCC) were cultured in DMEM medium (Lonza) supplemented with 10% fetal calf serum (FCS ...
-
bioRxiv - Physiology 2020Quote: ... supplemented with non-essential amino acids (1%, 100x Lonza), sodium-pyruvate (1% ...
-
bioRxiv - Cell Biology 2021Quote: ... ascorbic acid and heparin (EGM-2 SingleQuots Supplements, Lonza). Cells were grown in T-75 flasks ...
-
bioRxiv - Immunology 2021Quote: ... 1% (v/v) non-essential amino acids (NEAA) (Lonza), 2mM L-glutamine (Lonza) ...
-
bioRxiv - Immunology 2020Quote: ... 1% (v/v) MEM non-essential amino acids (Lonza), 100 U/ml penicillin ...
-
bioRxiv - Immunology 2022Quote: ... 1% 100x non-essential amino acid (Lonza #13-144E), 100 mM sodium pyruvate (Lonza #13-115E) ...
-
bioRxiv - Genomics 2022Quote: ... 100 μM non-essential amino acids (Lonza, #BE13-114E), 100 μM 2-mercaptoethanol (Gibco ...
-
bioRxiv - Microbiology 2023Quote: ... and 1% non-essential amino acids mixture (NEAA; Lonza). Cells were harvested using trypsin/EDTA ...
-
bioRxiv - Genomics 2019Quote: ... The products were size selected on a 3% NuSieve 3:1 Agarose gel (Lonza), purified using NucleoSpin Gel and PCR clean-up columns ...
-
bioRxiv - Genomics 2020Quote: ... donors (passage 2-3; Lonza) were continuously passaged to replicative exhaustion in complete Endopan-2 supplemented with 2% FBS under 5% CO2 ...
-
bioRxiv - Immunology 2019Quote: ... HAE cultures were grown in B-ALI medium supplemented with inducer (Lonza Inc.) at each media change with provision of an air-liquid interface for approximately 6 weeks to form differentiated ...
-
bioRxiv - Developmental Biology 2021Quote: ... Nucleofection was performed with program B-016 on an Amaxa Nucleofector II (Lonza). Cells were then grown for ten days under selection by 1 μg/mL puromycin and 10 μg/mL blasticidin ...
-
bioRxiv - Biophysics 2023Quote: ... 100 units/ml penicillin-streptomycin and 0.25 µg/ml amphotericin B (Lonza, Basel) are added ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.1 μg/mL amphotericin B (Biowest) and 10,000 U/mL penicillin/streptomycin (Lonza). Cells and PDECs were grown in a humidified incubator at 37◦C under 5% CO2 ...
-
bioRxiv - Microbiology 2024Quote: ... Transfection was performed using the Amaxa Nucleofector kit V program B-023 (Lonza) or Xcell PBS protocol ...
-
bioRxiv - Genetics 2023Quote: Plasmids were transfected using either the 4D Nucleofector (EBV B, Daudi, THP1; Lonza, 4D-Nucleofector Core Unit #AAF-1002B and 4D-Nucleofector X Unit #AAF-1002X) ...
-
bioRxiv - Bioengineering 2021Quote: ... HUVECs (Lonza, Passage <4) were cultured in an endothelial growth medium (C-22111 ...
-
bioRxiv - Cancer Biology 2022Quote: ... supplemented with ascorbic acid (75 μg/mL, Lonza, #CC-4398), human recombinant insulin (20 μg/mL ...
-
bioRxiv - Cell Biology 2021Quote: The A20 B-cell lymphoma line (ATCC #TIB-208) was cultured in DMEM (Lonza) supplemented with 10% of FBS (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2021Quote: ... 10,000μg/ml streptomycin and 25μg/ml amphotericin B (Fungizone) (PSF; Lonza, Walkersville, MD, USA). The following day ...
-
bioRxiv - Neuroscience 2022Quote: ... The nucleofection was performed using an Amaxa Nucleofector II (Lonza Bioscience, program B-016). After selection with 1 μg/ml puromycin ...
-
bioRxiv - Physiology 2022Quote: ... and 2.5 μg/mL amphotericin B in Hank’s balanced salt solution (HBSS) (Lonza, UK). It was then finely minced and digested overnight on a rocker at 4 °C in 1 mg/mL protease XIV (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2021Quote: ... HUVECs (Lonza, expanded to passage 3) were transduced with GFP tagged VE-cadherin (65 ...