Labshake search
Citations for Lonza :
201 - 250 of 1714 citations for 1R 2S 6R 7S 4 4 DIMETHYL 3 5 DIOXA 8 AZATRICYCLO 5.2.1.0 2 6 DECAN 9 ONE since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... about 8 × 105 iPSCs were transfected with 5 μg of plasmids with Lonza Human Stem Cell Nucleofector Kit 1 (Lonza, VPH-5012) on a Nucleofector 2b device (Lonza ...
-
bioRxiv - Immunology 2022Quote: ... The concentration of IL-2 was increased to 1000 IU/ml on day 7 and the expanded T cells were electroporated with the indicated mRNA at a concentration of 2 pg mRNA/cell on day 8 using 4D Nucleofector™ System (Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Transfections for specific recombination in TCIS clones were performed with the electroporation system (Amaxa Nucleofector 4; Lonza), to ensure essentially 100% transfection efficiency ...
-
bioRxiv - Bioengineering 2021Quote: Human bone marrow-derived MSCs were obtained from 4 different donors purchased from Lonza (Walkersville, MD, USA), AllCells (Emeryville ...
-
bioRxiv - Neuroscience 2022Quote: ... GFP expression plasmid was inserted into CAP-exosomes using 4-D-Nucleofector (instruments and reagents from Lonza, Basel ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the P3 Primary Cell 4D-Nucleofector X Kit for Amaxa 4-D device (Lonza, #V4XP-3032). 2×10E5 cells per condition were nucleofected in separated strip wells using program EO-100 ...
-
bioRxiv - Immunology 2023Quote: ... and the two lobes were separated and embedded in 4% low melting point agarose (Lonza, NJ, USA). 400µm thymic slices were generated by slicing the trimmed agarose blocks on a VT 1000S vibratome (Leica ...
-
bioRxiv - Developmental Biology 2024Quote: ... The nucleofection process was carried out using the DN100 program on the Amaxa 4-D Nucleofector (Lonza).
-
bioRxiv - Bioengineering 2024Quote: ... were cultured on a 0.1% gelatin-coated tissue culture dish at 37°C and 5% CO2 in Endothelial Cell Growth Medium - 2(EGM-2, Lonza, Basel, CH). HUVECs were transduced with mCherry lentiviral pseudovirus (pCDH-CMV-mCherry-T2A-Puro ...
-
bioRxiv - Neuroscience 2022Quote: ... Harvested EBs were transferred to a tissue-culture treated 6-well plate (Falcon, #353224) in 3 ml of EB Differentiation media: X-VIVO 15 (Lonza Biosciences, #04-418Q) + 1% Glutamax (Life Technologies ...
-
bioRxiv - Cell Biology 2020Quote: ... were resuspended at a density of 6×106 cells mL−1 in Microvascular Endothelial Cell Growth Medium-2 media (EGM-2MV, Lonza). The bottom channel of the chip was washed with EGM-2MV and loaded with 6 μL of HIMEC cell suspension (~36,000 cells per chip) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and E15.5 (n=2–6) Six2-TROMA-1 stained kidneys were embedded in 1 % low melting agar (50100; Lonza Group). The lateral cortex of the kidneys was imaged with a Nikon A1R MP+ multiphoton microscope (Tokyo ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Successful test compounds from the mf assay were diluted to 10 μM and added to the trans-wells in 6 ml endothelial basal media with supplements (EGM-2 MV; Lonza). Twelve replicates (n = 6 wells ...
-
bioRxiv - Bioengineering 2022Quote: ... 30 µl was mixed with 6 µl 6X gel loading dye and run on a 50 ml gel containing 2% SeaKem Agarose (Lonza), 1x Tris-Acetate-EDTA (Boston BioProducts) ...
-
bioRxiv - Bioengineering 2023Quote: ... washed three times in PBS and cultured on collagen-coated 6-well plates in endothelial growth medium (EGM-2, Lonza) composed of endothelial basal medium supplemented with 2% fetal bovine serum ...
-
bioRxiv - Cell Biology 2023Quote: ... cultured for 48 h at 37°C with 5% CO2 in EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (Lonza, UK) with penicillin–streptomycin (100_U/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... cultured for 48 h at 37°C with 5% CO2 in EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (Lonza, UK) with penicillin–streptomycin (100_U/ml ...
-
bioRxiv - Cancer Biology 2024Quote: ... were incubated at 37°C/5%CO2 and supplemented in 10% FBS and EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (Lonza, Switzerland). HUVECs and all other cancer cell lines were sub-cultured as adherent cells every 2-3 days.
-
bioRxiv - Immunology 2020Quote: ... 4 μl of the RNP-complex was added and transfected usine program CM150 of the nucleofection device (Lonza). After transfection cells were seeded in StemFlex™ medium (Thermo Fisher ...
-
bioRxiv - Genomics 2020Quote: ... that were then electroporated using a Lonza 4-D Nucleofector with 96-well Shuttle™ add-on (Lonza). Sequences of sgRNA can be found in Supplementary Table 2 ...
-
bioRxiv - Cancer Biology 2020Quote: ... One million cells were electroporated (Nucleofector, Lonza), and after 48h ...
-
bioRxiv - Cancer Biology 2021Quote: ... Primary uveal melanoma cells were equally divided onto two wells of a fibronectin-covered 6-well tissue culture plate and grown in 5% CO2 in MDMF medium which consists of HAM’s F12 (Lonza, Walkersville MD, USA) supplemented with 1 mg/mL BSA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA directed against Dsg1 (Integrated DNA Technologies) with a targeting sequence 5′-CCATTAGAGAGTGGCAATAGGATGA-3′ using Amaxa Nucleofector System (Lonza) for electroporation of cells according to manufacturer’s instructions.
-
bioRxiv - Neuroscience 2024Quote: ... and 300μM single stranded oligodeoxynucleotides (ssODN: 5’gggtccagggtggctgtcactcat ccttttttctggctaccaaaggtgcagataattaaGaagaagctggatcttagcaacgtccagccaagtgtggctcaaaggataatatc aaacacgtcc 3’) and the P3 Primary Cell 4D reaction mix (Lonza). We screened a minimum of 96 clones for genetic editing ...
-
bioRxiv - Immunology 2022Quote: Cryopreserved PBMC (2-5 × 106/sample) were thawed in prewarmed RPMI-1640 with L-glutamine (Lonza) + 10% FCS ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 and 5 were isolated from human nonparenchymal liver cells (NPCs) purchased from Lonza (cat# HUCNP) as described previously (Chen et al. ...
-
bioRxiv - Immunology 2022Quote: ... The solution was centrifuged at 400G for 5 minutes at 4°C and the cell pellet was resuspended in 1mL of Hank’s Balanced Salt Solution (HBSS; Lonza) containing 1% BSA (Sigma Aldrich ...
-
Epigenetic Interaction between UTX and DNMT1 Regulates Diet-Induced Myogenic Remodeling in Brown FatbioRxiv - Physiology 2020Quote: SiRNAs or overexpressing plasmids were transfected into day 4 differentiated BAT1 brown adipocytes using Amaxa Nucleofector II Electroporator (Lonza) with an Amaxa cell line nucleofector kit L according to the manufacturer’s instructions (Lonza ...
-
bioRxiv - Immunology 2020Quote: ... Aliquots of 4 · 105 cells were transferred into individual wells of 16-well or 96-well nucleofection cuvettes (Lonza), combined with 20 µL pre-formed RNP or nucleofector solution (no RNP control) ...
-
bioRxiv - Immunology 2023Quote: ... 1e6 cells were then mixed with either Cas9 or base editor mRNA (4 - 4.5 µg) and nucleofected with program EO-115 using a 4D Nucleofector (Lonza). Immediately after nucleofection ...
-
bioRxiv - Cell Biology 2024Quote: ... Ligase 4 was transiently complemented into KO cell lines by transfecting 500,000 cells with 100 ng of pmaxGFP (Lonza) and 500 ng of expression plasmid (empty vector ...
-
bioRxiv - Genomics 2024Quote: Transfection– K562-based CRISPR cell lines were nucleofected with 500 ng sgRNA plasmid DNA using 4-D nucleofector X Unit with 16-well nucleocuvette strips according to the manufacturer’s instructions (Lonza). For Casilio-i perturbations ...
-
bioRxiv - Microbiology 2022Quote: ... pre-coated cell culture 6-well plate with EBM-2 endothelial media supplemented with 10% FBS and a growth factor bullet kit (Lonza, Walkersville, USA) 3 mL/well ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... HESCs were transfected with a total of 4ug DNA in a ratio 2:3 (gRNAs:donor template) using the Amaxa P3 Primary Cell 4D-Nucleofector Kit (Lonza). Puromycin was added 3 days after electroporation at a concentration of 0.5ug/ml ...
-
bioRxiv - Cancer Biology 2024Quote: ... and (iv) the NDF-2 and NDF-3 cell lines (human neonatal dermal fibroblast cell lines, #CC-2509; Lonza Bioscience ...
-
bioRxiv - Developmental Biology 2020Quote: ... anti-sense RNA probe against Gdnf exons was transcribed and hybridized on thick sections derived from P4 kidneys embedded in 4% low melting agarose (NuSieve GTG, Lonza). BM purple was used for colorimetric reaction.
-
bioRxiv - Immunology 2021Quote: ... suspension CHO cells expressing wildtype human CTLA-4 were plated at 1 × 106 cells/well in DPBS (Lonza, Basel, Switzerland) containing 0.5% BSA (MilliporeSigma ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 μg of linearized plasmid containing wild-type or Ku70 3A cDNA was transfected using Amaxa nucleofector solution V (Lonza) and program T-020 ...
-
bioRxiv - Microbiology 2020Quote: ... The same number of cells (2 x 106 cells) were lysed in 100 µl of 1% CHAPS/PBS and analyzed on 4-20% SDS-PAGE gel (Lonza). The envelope proteins were detected by 2F5 (specific for gp41 ...
-
bioRxiv - Cell Biology 2022Quote: ... Expression of eGFP-Centrin1 was achieved by electroporating 4.106 B lymphoma cells with 4 μg of plasmid using the Amaxa Cell Line Nucleofector Kit R (T-016 program, Lonza). Cells were cultured in CLICK medium for 5 to 16 h before imaging.
-
bioRxiv - Biochemistry 2022Quote: ... and 18-36 μl ribonucleoprotein complexes were added along with 4 μM Alt-R Cas9 electroporation enhancer (IDT) to a nucleofection chamber (Lonza). Cells were electroporated using the nucleofector program EN-138 and gently resuspended in DMEM ...
-
bioRxiv - Cell Biology 2021Quote: ... or mutant) plasmids (4µg) were introduced to 4×106 dissociated neurons using Amaxa rat nucleofector kit (Lonza Bioscience, VPG-1003). Amaxa-nucleofected neurons plated at 500,000 cells per 35mm poly-D-lysine-coated glass bottom dish (WillCo Wells ...
-
bioRxiv - Microbiology 2020Quote: ... 20 µL of cell suspension was then gently mixed with each crRNP and aliquoted into a 96-well electroporation cuvette for nucleofection with the 4-D Nucleofector X-Unit (Lonza) using pulse code EO-120 ...
-
bioRxiv - Cell Biology 2021Quote: ... was generated by the introduction of a plasmid carrying the EGFP gene under the control of the CAG promoter to EStTA5-4 cells using the Amaxa Mouse ES cells Nucleofector Kit (VPH-1001, Lonza).
-
bioRxiv - Microbiology 2021Quote: ... Tightly synchronized schizonts were transfected using the Amaxa 4-D electroporator and P3 Primary Cell 4D Nucleofector X Kit L (Lonza) according to the protocol described by Moon et al ...
-
bioRxiv - Immunology 2020Quote: ... Cells were mixed with 5 μl of the RNP mixture by gently pipetting and were transferred to pre-cooled (4 °C) 16 well Nucleocuvette Strips (Lonza). Primary human B cells were nucleofected using the EH100 program of Lonza’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... Western blots were conducted by running equivalent amounts of protein on 4-20% Tris-Glycine SDS/polyacrylamide gradient gels (Lonza) after reduction with 2-mercaptoethanol and heating to 95°C for 5m ...
-
bioRxiv - Developmental Biology 2020Quote: ... 4 μg of plasmid DNA was introduced to 4×106 neurons using an AMAXA nucleofection kit (VPG-1001, VPG-1003; Lonza). AMAXA-nucleofected cells were plated in 35mm glass bottom imaging dishes ...
-
bioRxiv - Molecular Biology 2023Quote: ... the paired RNPs were combined and nucleofected into 4×105 Raw 264-7 cells suspended in 10 ul of nucleofection buffer (Lonza) using the program DS-136 in a 4D Nucleofector X Unit (Lonza) ...