Labshake search
Citations for Lonza :
201 - 250 of 1093 citations for 1 4 Bromo 3 methylphenyl ethanone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... All cell lines were cultured less than 3 months after resuscitation and tested for contaminants using MycoAlert (Lonza) every 1-3 months to ensure they were free of Mycoplasma contamination.
-
bioRxiv - Microbiology 2024Quote: ... and sporozoites were collected by centrifugation at 2,500 rpm for 3 min and resuspended in SF buffer (Lonza) containing 50 mg of tagging plasmid or 30 mg of linear targeting template and 30 mg CRISPR/Cas9 plasmid in a total volume of 100 ml ...
-
bioRxiv - Biochemistry 2024Quote: ... 3×105 cells were electroporated using P3 Primary Cell Nucleofector® 4D Kit and Nucleofector 4D system (Lonza) with 400 ng donor DNA ...
-
bioRxiv - Genomics 2020Quote: ... S2 cells were seeded at 2×106 per 6cm plate in 4 mL S2 medium (Lonza). One hour after plating ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4 μg guide RNA and 200 pmol ssODN using the Amaxa Nucleofector II (Lonza, Basel, Switzerland). Cells were recovered in growth medium for 24 hr and then sorted as single cells into 96-well plates by FACS ...
-
bioRxiv - Bioengineering 2023Quote: ... 2×109 Freestyle CHO-S cells were resuspended in 500ml ProCHO 4 Protein-free Medium (Lonza, Cat#BEBP12-029 ...
-
bioRxiv - Bioengineering 2024Quote: ... were cultured for a maximum of 4 passages cultured in EGM™-2 (Lonza #CC-4176) in T-175 or T-75 culture flasks (Thermo ...
-
bioRxiv - Cancer Biology 2024Quote: ... following the CA-137 program recommended by the manufacturer for MOLT-4 cells (Lonza, V4XC-2032). Post-electroporation ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA directed against Dsg1 (Integrated DNA Technologies) with a targeting sequence 5′-CCATTAGAGAGTGGCAATAGGATGA-3′ using Amaxa Nucleofector System (Lonza) for electroporation of cells according to manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2022Quote: ... 3 µL of the sgRNA (total 300 pmol) was added to 12 µL of SE buffer (Lonza V4XC-1032). In another well ...
-
bioRxiv - Biochemistry 2021Quote: ... For each nucleofection 3 x 106 cells were resuspended in 80 μl of mouse ES cell nucleofection solution (Lonza). Equimolar (0.32 nmol ...
-
bioRxiv - Cancer Biology 2020Quote: ... were used in passages 3-6 and cultured on 0.1% gelatin-coated tissue culture plates in complete EGM2 (Lonza) supplemented to a total of 10% Fetal Bovine Serum (FBS) ...
-
bioRxiv - Developmental Biology 2021Quote: ... HESCs were transfected with a total of 4ug DNA in a ratio 2:3 (gRNAs:donor template) using the Amaxa P3 Primary Cell 4D-Nucleofector Kit (Lonza). Puromycin was added 3 days after electroporation at a concentration of 0.5ug/ml ...
-
bioRxiv - Cancer Biology 2024Quote: ... and (iv) the NDF-2 and NDF-3 cell lines (human neonatal dermal fibroblast cell lines, #CC-2509; Lonza Bioscience ...
-
bioRxiv - Bioengineering 2024Quote: ... and SK-BR-3 cells (Korean Cell Line Bank, Korea) were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Lonza, Switzerland) supplemented with 10 % (v/v ...
-
Self-organised pattern formation in the developing neural tube by a temporal relay of BMP signallingbioRxiv - Developmental Biology 2023Quote: A total of 3-4µg of plasmid DNA was electroporated into 3-4x106 early passage ES cells using the Amaxa Nucleofector II (Lonza) programme A-023 ...
-
bioRxiv - Cell Biology 2022Quote: Human umbilical vein endothelial cells (HUVEC) were cultured between passage 3 and 6 in EGM-2 complete medium (Lonza)3,52–55 ...
-
bioRxiv - Cell Biology 2022Quote: Normal human bronchial epithelial cells (HBECs) from 3 independent donors (Supplemental Table S1) were obtained from Lonza (CC-2540) and cultured in BEGM growth media (Lonza CC-3170) ...
-
bioRxiv - Biophysics 2023Quote: ... DNA samples were also analyzed by electrophoresis through 1.5 % and 3 % agarose gels (Seakem LE agarose, Lonza, Rockland, ME) in TAE (Tris-acetate + 1 mM EDTA ...
-
bioRxiv - Genetics 2024Quote: ... Approximately 2.5×105 CD34+ HSPCs were mixed with gRNA:Cas9 complexes and 3 µg ssDNA donor template (20 μL) in nucleofector strip format (Lonza). Electroporation was performed in Unit X ...
-
bioRxiv - Neuroscience 2024Quote: ... and 300μM single stranded oligodeoxynucleotides (ssODN: 5’gggtccagggtggctgtcactcat ccttttttctggctaccaaaggtgcagataattaaGaagaagctggatcttagcaacgtccagccaagtgtggctcaaaggataatatc aaacacgtcc 3’) and the P3 Primary Cell 4D reaction mix (Lonza). We screened a minimum of 96 clones for genetic editing ...
-
bioRxiv - Cell Biology 2024Quote: ... NHEKs (no later than passage 3) were cultured in KGM Gold Keratinocyte Growth Medium BulletKit (00192060, Lonza, Basel, Switzerland). For daily maintenance and subculturing of NHEKs ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1% of penicillin-streptomycin and 1% of Ultraglutamine-1 (Lonza, Basel, Switzerland). U-2 OS cells were grown in high-glucose DMEM (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... Transfections for specific recombination in TCIS clones were performed with the electroporation system (Amaxa Nucleofector 4; Lonza), to ensure essentially 100% transfection efficiency ...
-
bioRxiv - Bioengineering 2021Quote: Human bone marrow-derived MSCs were obtained from 4 different donors purchased from Lonza (Walkersville, MD, USA), AllCells (Emeryville ...
-
bioRxiv - Cell Biology 2021Quote: ... Passaging of iPSCs was carried out every 4-5 days using Versene (EDTA 0.02%) (Lonza, BE17–771E) solution for 3–5⍰minutes at 37⍰°C ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Sf9 cells (4 × 105 cells* ml) in 2 ml of Insect-Xpress medium (Lonza, Walkersville, MD, USA) were transfected with recombinant bacmids using Cellfectin reagent (Life Technologies) ...
-
bioRxiv - Neuroscience 2022Quote: ... GFP expression plasmid was inserted into CAP-exosomes using 4-D-Nucleofector (instruments and reagents from Lonza, Basel ...
-
bioRxiv - Cell Biology 2021Quote: ... immature RPE cells were seeded at a density of 1 × 105 cells/cm2 onto growth factor reduced ECMH (Corning)-coated transwells and allowed to be mature for 4-6 weeks in RPE medium (XVIVO 10, Lonza). Matured RPE at P1 or P2 were used in downstream experiments.
-
bioRxiv - Biochemistry 2023Quote: ... ∼2-4 million cells were electroporated using the T020 method of the Nucleofector™ 2b device (Lonza). Immediately after electroporation ...
-
bioRxiv - Cell Biology 2022Quote: ... ∼2-4 million cells were electroporated using the T020 method of the Nucleofector™ 2b device (Lonza). Immediately after electroporation ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the P3 Primary Cell 4D-Nucleofector X Kit for Amaxa 4-D device (Lonza, #V4XP-3032). 2×10E5 cells per condition were nucleofected in separated strip wells using program EO-100 ...
-
bioRxiv - Immunology 2023Quote: ... and the two lobes were separated and embedded in 4% low melting point agarose (Lonza, NJ, USA). 400µm thymic slices were generated by slicing the trimmed agarose blocks on a VT 1000S vibratome (Leica ...
-
bioRxiv - Cell Biology 2024Quote: ... were used in passages 4-8 and expanded in flasks in Fibroblast Basal Medium (Lonza, #CC-3131) with FGM2-Fibroblast Growth Medium BulletKit (Lonza ...
-
bioRxiv - Developmental Biology 2024Quote: ... The nucleofection process was carried out using the DN100 program on the Amaxa 4-D Nucleofector (Lonza).
-
bioRxiv - Physiology 2022Quote: ... in F12 : DMEM (1 : 1) (Lonza, UK). Following digestion the suspension was passed through sterile gauze and a 70 µm cell strainer before centrifugation at 350 g for 10 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... resuspended 1:1 in XVIVO-15 (Lonza) and 3% bovine serum albumin (BSA) ...
-
bioRxiv - Microbiology 2020Quote: ... Infected CD4 T cells were washed with PBS and 3 million cells per condition were resuspended in 20uL buffer P2 (Lonza) with 4μM IDT electroporation enhancer ...
-
bioRxiv - Immunology 2022Quote: ... Thawed PBMCS were rested for 3-4h at 37°C in X-VIVO 15 Serum-free Hematopoietic Cell Medium (Lonza) supplemented with 5% human Ab serum ...
-
bioRxiv - Neuroscience 2020Quote: ... The spinal cord was spun at 3000 rpm for 3 min at room temperature after which the embryonic medium was replaced with 1x trypsin-EDTA (Lonza). The tissue was macerated in trypsin and incubated at 37°C for 15-20 mins ...
-
bioRxiv - Microbiology 2021Quote: ... Viral supernatants were collected 3 and 6 days post-infection and induced-cell death and viral titers were determined in the ToxiLight Bioassay (Lonza) and PFA ...
-
PSGL-1 inhibits HIV-1 infection by restricting actin dynamics and sequestering HIV envelope proteinsbioRxiv - Microbiology 2020Quote: ... 1×106 activated CD4+T cells were stimulated by IFN-γ for 24 h before being transfected with 3 siRNAs following Amaxa Nucleofector following the manufacturer’s protocols (Lonza). Two days post transfection ...
-
bioRxiv - Cell Biology 2022Quote: ... All cell lines were tested to be negative for mycoplasma every 2–3 months using the MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Cell Biology 2022Quote: ... and diseased COPD human lung fibroblasts (DHLFs) from 3 donors (donor IDs: OF3353, OF3418 and OF3238) were purchased from Lonza and tested for their response to FGF2 and TGFβ stimulation.
-
bioRxiv - Cancer Biology 2022Quote: ... and then combined with 3 µL of RNP mixture and nucleofected using program DJ-110 (melanoma) or EH100 (TILs) on a 4D Nucleofector (Lonza). Melanoma cells were immediately recovered in full melanoma media in 12-well plates ...
-
bioRxiv - Genetics 2020Quote: ... hESCs were nucleofected with 2 μg of CRISPR and 3 μl ssODN (100 μm) using the P3 Primary Cell Kit L (Lonza). hESCs were then plated onto puromycin-resistant (DR4 ...
-
bioRxiv - Microbiology 2021Quote: ... The human lung epithelial cell line Calu-3 (ATCC HTB-55) was maintained in DMEM F-12 (Lonza, Basel, Switzerland) supplemented with 10% FBS ...
-
bioRxiv - Bioengineering 2023Quote: Ha deposition was detected staining constructs sections (n≥10 from n≥3 chambers considering two different hACs and two different MSCs donors) with OsteoImage (Lonza) as detailed above ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5.0-8.0 × 105 BTAG cells were electroporated with 3 μg of each gRNA using Amaxa 4D nucleofector (Lonza, V4XP-3012) and the CA-137 program ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...