Labshake search
Citations for Lonza :
201 - 250 of 1662 citations for 1 3 Nitro 10 11 dihydro 5H dibenzo b f azepin 5 yl ethanone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: Sinonasal epithelial cells were enzymatically dissociated and grown to confluence in proliferation medium (50% DMEM/Ham’s F-12 plus 50% bronchial epithelial basal media [BEBM] plus Singlequot supplements; Lonza, Walkersville, MD, USA) for 7 days [21] ...
-
bioRxiv - Neuroscience 2021Quote: ... embedded in 3% agarose (Lonza, # 50004, Rockland, ME, USA) and coronally sectioned (Leica VT1000S vibratome ...
-
bioRxiv - Cancer Biology 2020Quote: ... supplemented with 5% decomplemented FBS (Lonza), 1 M HEPES (Sigma) ...
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with horse serum (5%, Lonza), recombinant human insulin (5 ug/mL) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5% heat-inactivated horse serum (Lonza), 0.01 mg/ml insulin (Gibco) ...
-
bioRxiv - Immunology 2023Quote: ... 1999) cultured in I10 media (Iscove’s modified Dulbecco’s Medium, 10% FBS, 1:1000 MycoZap; Thermo Fisher and Lonza) supplemented with 100 ng/mL IL-21 (Gibco ...
-
bioRxiv - Molecular Biology 2023Quote: ... program A-30 with 10 µg of plasmid DNA and 1 µg of eGFP control plasmid (Amaxa, Lonza) was used ...
-
bioRxiv - Immunology 2024Quote: ... 1-10 million of pre-activated P14 cells were resuspended in 20 μl of P4 Nucleofection Buffer (Lonza). This cell suspension was then mixed with sgRNA/Cas9 and then incubated at room temperature for 2 mins ...
-
bioRxiv - Microbiology 2022Quote: ... NHBE cells were infected with viruses at an MOI of 0.01 and cultured in B-ALI growth medium (Lonza) at 33°C ...
-
bioRxiv - Developmental Biology 2020Quote: ... Cells were nucleofected with 10ug lineage recorder DNA and 1ug Sleeping Beauty transposase following the manufacturer’s protocol and using the B-16 program of the Nucleofector 2b (Lonza) in cuvettes for 100μl Human Stem Cell nucleofection buffer (Lonza ...
-
bioRxiv - Bioengineering 2023Quote: ... 0.1% r-human fibroblast growth factor (rhFGF) and 0.1% Gentamicin sulfate amphotericin-B (GA-1000) (Lonza, Quakertown, PA, USA). HLFs were used from passages 1 to 10 ...
-
bioRxiv - Immunology 2024Quote: ... plasmid containing the sgRNA sequence: GGGGCCACTAGGGACAGGAT using nucleofection according to the manufacturer’s specifications (Lonza 4D Nucleofector, B-cell protocol) at a DNA mass ratio of 4:1 donor to Cas9 plasmid ...
-
bioRxiv - Bioengineering 2023Quote: ... in passages 5-8 were cultured at 37°C and 5% CO2 in EGM2 cell medium (Lonza). Cells were detached from the adhering surface using TrypLE (Life Technologies ...
-
bioRxiv - Immunology 2023Quote: ... Md) and cultured overnight at 37C culture at 378C with 5% CO2 in serum free HL-1 media (Lonza, Walkersville, Md) supplemented with Pen-Strep and 8 mmol/L Glutamax (Gibco ...
-
bioRxiv - Microbiology 2020Quote: ... 10 mM Hepes (Lonza), 1.5 mg ml−1 sodium bicarbonate (NaHCO3 ...
-
bioRxiv - Immunology 2022Quote: ... 10 mM HEPES (Lonza)] supplemented with 10% human serum (HS) ...
-
bioRxiv - Microbiology 2020Quote: ... 10 mM Hepes (Lonza) and 0.25 mg/ml fungizone (Invitrogen) ...
-
bioRxiv - Microbiology 2020Quote: ... 10 mM Hepes (Lonza) and 0.25 mg/ml fungizone (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... 10 mM Hepes (Lonza) and 1x nonessential amino acids (Lonza ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing 10% FCS (Lonza),2 mM L-Glutamin ...
-
bioRxiv - Physiology 2020Quote: ... 10% Ham’s F12 (Lonza), 0.5% Pen-Strep (Gibco) ...
-
bioRxiv - Microbiology 2020Quote: ... 10 mM Hepes (Lonza) and 1x nonessential amino acids (Lonza) ...
-
bioRxiv - Microbiology 2020Quote: ... 10 mM Hepes (Lonza), and 1x nonessential amino acids (Lonza).
-
bioRxiv - Microbiology 2020Quote: ... 10 mM Hepes (Lonza), 1x nonessential amino acids (Lonza ...
-
bioRxiv - Developmental Biology 2023Quote: ... 10 mM HEPES (Lonza) and 1% penicillin/streptomycin (Lonza) ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR products were resolved on 3% Metaphor agarose gel (Lonza), and DNA fragments of sizes approximately 150-200 nt were isolated from the gel using Qiagen’s Gel Extraction Kit (Figure 1D) ...
-
bioRxiv - Bioengineering 2020Quote: ... Cells were maintained in FGM-3 Medium (CC-4526, Lonza) and passaged at 80% confluence.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... CF patient# 3 (#28388-0000450918, Lonza, male, 25 years-old) and four non-CF donors with no pathology reported ...
-
bioRxiv - Neuroscience 2022Quote: ... brains were embedded in 3% agarose (SeaKem LE Agarose, Lonza). 150 μm thick vibratome sections (VT1000S vibratome ...
-
bioRxiv - Neuroscience 2022Quote: ... brains were embedded in 3% agarose (SeaKem LE Agarose, Lonza) and vibratome-sectioned (VT1000S vibratome ...
-
bioRxiv - Systems Biology 2024Quote: ... and finally resuspended in a cold SSC cocktail (3× Lonza AccuGENE SSC ...
-
bioRxiv - Microbiology 2022Quote: Sterile molten top NA (3 mL; 0.2 % SeaPlaque Agarose, Lonza) supplemented with CaCl2 and MgCl2 (both at 5 mM ...
-
bioRxiv - Biochemistry 2020Quote: HEK293T cells were maintained in DMEM (Dulbecco’s modified Eagle’s high glucose medium) supplemented with 10% (v/v) FBS (foetal bovine serum) and 1% antibiotic/antimycotic (Lonza) in a humidified incubator with 10% CO2.
-
bioRxiv - Immunology 2023Quote: moDCs were cultured with allogenic naïve CD4+ T cells in a 1:10 ratio in complete IMDM (IMDM (BE12- 722F, Lonza) with 100 U/mL penicillin ...
-
bioRxiv - Cell Biology 2022Quote: ... Expression of eGFP-Centrin1 was achieved by electroporating 4.106 B lymphoma cells with 4 μg of plasmid using the Amaxa Cell Line Nucleofector Kit R (T-016 program, Lonza). Cells were cultured in CLICK medium for 5 to 16 h before imaging.
-
bioRxiv - Neuroscience 2022Quote: ... and 252 pmol Cas9-HiFi or Cpf1-Ultra (both IDT) using the B-16 program of the Nucleofector 2b Device (Lonza) in cuvettes for 100 µl Human Stem Cell nucleofection buffer (Lonza ...
-
bioRxiv - Immunology 2022Quote: ... Knockdown of Vps4a/b was performed using Amaxa Nucleofector II and the Mouse T-Cell Nucleofector Kit (Lonza, Basel, Switzerland) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... containing a combination of the px458 plasmid targeting each gene and the ssODN and then electroporated using B-016 program of Nucleofector 2b (Lonza). The electroporated GSCs were cultured for 48 h followed by Single cell sorting of GFP-positive cells (SH800 ...
-
bioRxiv - Cell Biology 2024Quote: ... Differentiation medium consisted of 50 % DMEM with pyruvate and 50 % BEBM supplemented with BEGM singlequots (except amphotericin B, triiodothyronine, and retinoic acid) (Lonza). Medium was supplemented with 100 nM all-trans retinoic acid (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2024Quote: ... NHDF cells were cultured in FBM fibroblast basal media (supplemented with FGM-2 SingleQuot supplements: insulin, hEGF-B, GA-1000, and FBS) (Lonza). NHEK cells were expanded in KBM gold basal medium (KGM gold supplemented with Lonza’s SingleQuot supplements ...
-
bioRxiv - Neuroscience 2023Quote: ... we used the human iPSC line SFC840-03-01 (STBCi026-B) generated within the StemBANCC project (part of Innovative Medicines Initiative) based on a commercially available fibroblast line (Lonza) from a healthy 67-years old female donor (Morrison et al. ...
-
bioRxiv - Immunology 2022Quote: ... was prepared by mixing 250 nmol target gene sgRNA+ 50 nmol eGFP sgRNA+ 50 nmol SpCas9 2NLS Nuclease (Synthego) in 50 μL mouse B cell nucleofection buffer (Lonza) at RT for 30min ...
-
bioRxiv - Bioengineering 2022Quote: ... B and T cell electroporations were performed using the Amaxa™ 96-well Shuttle™ with the 4D Nucleofector (Lonza). HSPC electroporations were performed in MaxCyte ATx ...
-
bioRxiv - Biochemistry 2022Quote: ... ALI culture conditions were initiated when cells reached confluence by removal of apical medium and replacement of basolateral growth medium with B-ALI differentiation medium (cat# 193517, Lonza) supplemented with SingleQuots (cat# 193515 ...
-
bioRxiv - Cell Biology 2024Quote: ... Differentiation medium consisted of 50% DMEM and 50% BEBM supplemented with BEGM SingleQuots (except amphotericin B, triiodothyronine, and retinoic acid; CC-3171 and CC-4175, Lonza). Medium was supplemented with 100 nM all-trans retinoic acid (R2625 ...
-
bioRxiv - Cell Biology 2024Quote: ... The recombination donor and the gRNA expressing plasmids were transfected to WT abl pre-B cells expressing Cas9 using the 4D Nucleofector (Lonza) with the SG Cell Line 4D-Nucleofector™ X Kit L and the pulse code CM147 ...
-
bioRxiv - Microbiology 2021Quote: ... in Pro-CHO-5 media (Lonza, Switzerland).
-
bioRxiv - Immunology 2021Quote: ... 5% CO2 in X-VIVO 15 (Lonza) supplemented with 5% (v/v ...
-
bioRxiv - Molecular Biology 2023Quote: ... supplemented with 5% human AB serum (Lonza), Interleukin-2 (50 ng/mL ...
-
bioRxiv - Immunology 2022Quote: ... 5% CO2 culture medium (RMPI-1640 (Lonza) supplemented with 10% FBS (Gibco) ...