Labshake search
Citations for Lonza :
2301 - 2350 of 2633 citations for Human Bcl2 Associated Death Promoter BAD ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... and pCMV-Pbase (0.2µg) (kindly provided by L. Tiberi) using P1 Primary Cell 4D-NucleofectorTM X Kit L (Lonza; V4XP-1024) Amaxa Nucleofector (program FF104 ...
-
Antibodies targeting Crimean-Congo hemorrhagic fever virus GP38 limit vascular leak and viral spreadbioRxiv - Microbiology 2024Quote: ... All endothelial cells were cultured in endothelial cell growth basal medium 2 supplemented with an Endothelial Cell Growth Medium-2 (EGM-2) microvascular cells supplemental bullet kit (Lonza) and maintained at 37 °C with 5% CO2.
-
bioRxiv - Neuroscience 2024Quote: ... along with 20 μg recombinant Cas9 (IDT) and 1 pmol of each bridging oligonucleotide using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) using the CA-137 program34 ...
-
bioRxiv - Neuroscience 2024Quote: ... 500 pmol Cas12 crRNA (GGAAAAGTAAAAGATGTCTGAAT, IDT) and 20 μg recombinant Cas12 (IDT) using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) and 4D-Nucleofector X unit (Lonza ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2×105 cells were electroporated with 250 ng of gRNA plasmids and 750 ng of CBE using the SF Cell Line Nucleofector X Kit (Lonza) via the 4D-Nucleofector system ...
-
bioRxiv - Molecular Biology 2024Quote: ... Schizonts were transfected by electroporation using the Lonza 4D Nucleofector System according to the pulse program FI-115 with the P3 Primary Cell 4D-Nucleofector X Kit S (Lonza). After transfection ...
-
bioRxiv - Molecular Biology 2024Quote: ... CD34+ HSPCs (2x105 cells/condition) were transfected with RNP complexes using the P3 Primary Cell 4D-Nucleofector X Kit S (Lonza) and the CA137 program (Nucleofector 4D ...
-
bioRxiv - Molecular Biology 2024Quote: Cells were electroporated using the Lonza 4D Nucleofector device according to manufacturer instructions for the SE Cell Line kit (V4XC-1024, Lonza). Cells were recovered immediately into fresh media and re-seeded ...
-
bioRxiv - Immunology 2024Quote: ... Stable knockout of CYLD was generated using CRISPR/Cas9 system and SG cell line 4D-nucleofector X kit (#V4XP-3024, Lonza) according to the manufactureŕs protocol ...
-
Synchronous 3D patterning of diverse CNS progenitors generates motor neurons of broad axial identitybioRxiv - Neuroscience 2024Quote: ... For the generation the ISL1 reporter line cells were nucleofected with pTG-Cr-ISL1 and pTG-HR-ISL1-p2A-mNeonGreen plasmids using a 4-D nucleofector system (AMAXA) and the P3 Primary Cell 4D-Nucleofector Kit (Lonza) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were grown at 37°C in a humidified incubator with 5% CO2 and were regularly performed mycoplasma test using a MycoAlert Mycoplasma Detection kit (Lonza). Cells with mycoplasma-free were used for experiments.
-
bioRxiv - Bioengineering 2024Quote: ... expression constructs were generated using BAC (bacterial artificial chromosomes) vectors and transfected using Amaxa Nucleofector Kit V (Lonza; VCA-1003). Upon selection using neomycin (1 to 1.5 mg/mL) ...
-
bioRxiv - Bioengineering 2024Quote: ... The cell lines were propagated in antibiotic free medium and were monitored regularly for mycoplasma infection using MycoAlertTM PLUS Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Bioengineering 2024Quote: 3·106 BRPKp110 cells were resuspended in 20 µl primary cell nucleofection solution (P4 Primary Cell 4D-Nucleofector X kit S (32 RCT, V4XP-4032; Lonza). Cells were mixed and incubated with 15 µl RNP at room temperature for 2 minutes ...
-
bioRxiv - Cancer Biology 2024Quote: ... All cells were maintained at 37 °C in a 5% CO2 humidified atmosphere and regularly screened for the presence of mycoplasma using the MycoAlert Mycoplasma Detection Kit (Lonza). Cell lines were cultured for no more than 20 passages following thawing ...
-
bioRxiv - Cancer Biology 2024Quote: ... Mycoplasma cell culture contamination was routinely checked and ruled out using the MycoAlert Mycoplasma Detection Kit (Lonza; Rockland, ME USA). Gefitinib and Osimertinib were purchased at Selleck Chemicals LLC (Houston ...
-
bioRxiv - Bioengineering 2024Quote: ... and resuspended at a concentration of 2.5 x 105 cells in 20 μl of pre-mixed P3 Primary Cell 4D-Nucleofector solution (P3 Primary Cell 4D-Nucleofector X Kit S, Cat: V4XP-3032; Lonza). Cells were combined with the RNP/HDR plasmid solution and transferred into individual wells of a 16-well Nucelocuvette Strip (Lonza) ...
-
bioRxiv - Biochemistry 2024Quote: ... All cells were cultured at 37°C in 5% CO2 in humidified incubators and were free from mycoplasma (MycoAlert Detection Kit, Lonza).
-
bioRxiv - Cancer Biology 2024Quote: ... Cell lines were confirmed to be mycoplasma-negative using the Mycoalert PLUS Mycoplasma detection kit (Lonza, Cat. No.: LT07-703).
-
bioRxiv - Cancer Biology 2024Quote: ... J-064151-12)] co-transfected with 100 ng pCMMP-MCS-IRES-mRFP using NucleofectorTM kit (cat#. VPA-1003, Lonza, Germany). GFP+ (MSH2 Knockdown ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell lines and organoids were tested regularly to confirm the absence of mycoplasma using Mycoalert mycoplasma detection kit (LT07, Lonza).
-
bioRxiv - Cell Biology 2024Quote: ... following the protocols provided by the manufacturers using the Basic Nucleofector™ Kit for Primary Mammalian Fibroblasts (VPI-1002, Lonza). After transfection ...
-
bioRxiv - Developmental Biology 2024Quote: ... the PB-Tre-BMP4 and PB-blue plasmids were co-transfected into H9 using the P3 Primary Cell 96-well Nucleofector Kit (Lonza) and the 4D Nucleofector×Unit (Lonza ...
-
bioRxiv - Developmental Biology 2024Quote: ... Donor and TALEN plasmids were nucleofected into WTC-hNIL stem cells using the P3 Primary Cell 4D Nucleofector X Kit (Lonza). Cells were then selected for with G418 and integration was confirmed using junction PCR (Supplemental Table 3) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Mycoplasma detection was routinely performed to ensure cells were not infected with mycoplasma by using MycoAlert Detection kit (Lonza, LT07-218). Cells were maintained at 37°C in a 5% CO2 incubator ...
-
bioRxiv - Cancer Biology 2021Quote: ... and transferred to the well of a 16-well Nucleocuvette™ strip (SF Cell Line 4D-NucleofectorTM X Kit S, Lonza). Cells were electroporated on a 4D-NucleofectorTM X Unit (Lonza ...
-
bioRxiv - Cell Biology 2020Quote: Microspheres were tested for LPS contamination using the Limulus Amebocyte Lysate (LAL) QCL-1000™ kit (Lonza Walkersville, Inc., Olten, Switzerland) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... The cells were tested for mycoplasma on receipt of the cell line and quarterly thereafter using the MycoAlert Mycoplasma Detection Kit according to the manufacturer’s instructions (Lonza, Basel, Switzerland).
-
bioRxiv - Immunology 2021Quote: ... All generated THP1 and iMAC clones were tested negative for mycoplasma contamination using MycoAlert Mycoplasma Detection Kit (Lonza, Cat#LT07-318). THP1 cells were obtained from ATCC ...
-
bioRxiv - Developmental Biology 2020Quote: ... and nucleofected with BioID constructs using an Amaxa Nucleofector II and the Mouse Neural Stem Cell Nucleofector Kit (Lonza; VPG-1004) according the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: CRISPR plasmid constructs (2 μg) were electroporated into 2 × 106 Raji cells using the Amaxa Cell Line Nucleofector Kit V (Lonza Bioscience) (Program M-013) ...
-
bioRxiv - Neuroscience 2021Quote: ... Neuronal nucleofections were performed immediately before plating at 0 DIV by using an Amaxa Nucleofection Kit (Lonza, Basel, Switzerland, VPG-1003) according to the manufacturer’s optimized protocol (Number 101 ...
-
bioRxiv - Molecular Biology 2020Quote: ... by nucleofection using the Basic Nucleofector Kit for Primary Mammalian Fibroblasts with programme A-24 according to the manufacturer’s instructions (Lonza, Cologne, Germany). Cell clones were isolated after approximately 12 days of puromycin selection (1.5 µg/mL) ...
-
bioRxiv - Cell Biology 2020Quote: BMDMs (1 × 106 cells) were transfected with siRNA (250 pmol) and Amaxa Mouse Macrophage Nucleofector Kit (Lonza, catalog number VPA-1009) using a Lonza Nucleofector 2b device (Lonza ...
-
bioRxiv - Microbiology 2021Quote: ... pcDNA3-JUP or empty vector were transfected into Caco-2 cells using SE Cell Line 4D-Nucleofector™ X Kit (Lonza) and an Amaxa 4D Nucleofector device from Lonza ...
-
bioRxiv - Genomics 2021Quote: ... Cell lines were authenticated by STR profiling and mycoplasma testing was performed using the MycoAlert™ PLUS Mycoplasma Detection Kit (Lonza). U2OS cells were grown in DMEM supplemented with 10% tetracycline-free foetal bovine serum (Clontech) ...
-
bioRxiv - Neuroscience 2020Quote: ... All cells were routinely tested for mycoplasma contamination with MycoAlert Mycoplasma Detection Kit (Lonza, Rockland, ME, USA, Cat N° LT07-318). Chemicals and cell culture reagents were purchased from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Cancer Biology 2020Quote: ... while MCF-10A cells were cultured as per ATCC recommendations in MEGM bullet kit growth media (CC-3150; Lonza, Walkersville, MD) without gentamycin-amphotericin B mix but with additional 100ng/ml cholera toxin (C8052 ...
-
bioRxiv - Cell Biology 2021Quote: Cell lines were cultured according to standard aseptic mammalian tissue culture protocols in 5% CO2 at 37 °C with regular testing for mycoplasma contamination using the MycoAlert™ Mycoplasma Detection Kit (Lonza). HCT 116 ...
-
Rag GTPases and Phosphatidylinositol 3-Phosphate Mediate Recruitment of the AP-5/SPG11/SPG15 ComplexbioRxiv - Cell Biology 2020Quote: ... The cell lines were routinely tested for the presence of mycoplasma contamination using MycoAlert™ Mycoplasma Detection Kit (LT07-318, Lonza), and were also regularly treated with mycoplasma removing agent (093050044 ...
-
bioRxiv - Cancer Biology 2021Quote: ... in a total volume of 100μL/ reaction and electroporated using an Amaxa TM Basic Nucleofector TM Kit for Primary Mammalian Epithelial cells (Lonza, # VPI-1005) and the NucleofectorTM 2b Device (Lonza ...
-
bioRxiv - Immunology 2022Quote: ... cells were resuspended with 10µL of primary cell nucleofection solution (P3 primary Cell 4D-Nucleofector X kit S (Lonza, # V4XP-3032), and mixed with RNP complexes ...
-
bioRxiv - Developmental Biology 2022Quote: ... and all cell lines are routinely monitored for mycoplasma infection monthly using the MycoAlert Mycoplasma Detection Kit (Lonza, Cat#LT08-118). Stem cells were maintained as previously described (Spence et al. ...
-
bioRxiv - Microbiology 2022Quote: ... Residual endotoxins in the purified phage preparations were determined by the Limulus Amebocyte Lysate (LAL) Kinetic-QCL Kit (Lonza, Basel, Switzerland) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2022Quote: ... Cells were negative for mycoplasma contamination and are regularly tested using the MycoAlert PLUS Mycoplasma Detection Kit (Lonza, Rockville, MD, USA). Unless stated otherwise ...
-
bioRxiv - Genomics 2022Quote: mESC were transfected with sgRNA constructs using the P3 Primary Cell 4D-Nucleofector X Kit (V4XP-3024) and the Amaxa 4D Nucleofector™ system (Lonza). We used the transfection programme CG-104 ...
-
bioRxiv - Bioengineering 2022Quote: ... the basal channels of the Intestine Chips were first rinsed with endothelial cell culture medium consisting of stem cell medium supplemented with components from EGM™-2 MV Microvascular Endothelial SingleQuots Kit (CC-4147; Lonza), and then 50 μL HIMECS (450,000 cells/chip ...
-
bioRxiv - Microbiology 2021Quote: ... HPMEC were cultured in endothelial cell growth basal medium 2 supplemented with an Endothelial Cell Growth Medium-2 (EGM-2™) supplemental bullet kit (Lonza). Cells were maintained at 37°C with 5% CO2 ...
-
bioRxiv - Microbiology 2021Quote: ... The Ala324Thr and the Glu655Asp mutations were independently recreated by transfecting the respective sgRNA template and donor dsDNA using the Basic Parasite Nucleofector™ Kit 1 (Lonza) with the U-033 program following manufacturer recommendations ...
-
bioRxiv - Microbiology 2021Quote: ... DNA electroporation was conducted following the Amanxa® Cell line nucleofector protocol using the Cell Line Nucleofector® Kit R (Lonza). 2 μg plasmid DNA was used per reaction and electroporation was carried out using the I-013 program for high expression efficiency of HeLa cells ...