Labshake search
Citations for Lonza :
2201 - 2250 of 3057 citations for Human Xylosyltransferase 1 XYLT1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... All cell lines were regularly tested for mycoplasma contamination using a biochemical test kit (#LT07-318, Lonza, Switzerland) and were free of mycoplasma contamination.
-
bioRxiv - Cell Biology 2022Quote: ... 25 μg mRNA was transfected into 2.5 × 106 freshly thawed fibroblasts using Cell Line Nucleofector Kit V (Lonza) and AMAXA program X-001 following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Transient transfections of these dominant-negative Rab11 a and siRab11 a into mouse MΦs (RAW 264.7 cell line) were performed with Amaxa mouse macrophage nucleofector kit (VPA-1009, Lonza) and DharmaFECT 4 Transfection Reagent (T-2004-01 ...
-
bioRxiv - Cell Biology 2022Quote: ... All cell lines were routinely tested for mycoplasma contamination by using the MycoAlert PLUS Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Cultures were confirmed to be free of mycoplasma infection using the MycoAlert Mycoplasma Detection Kit (Lonza, Walkersville, MD). Briefly ...
-
bioRxiv - Microbiology 2023Quote: ... Parasites and host cells were regularly tested for Mycoplasma contamination using the Mycoalert detection kit (Lonza; Basel, Switzerland). For all assays ...
-
bioRxiv - Molecular Biology 2023Quote: ... All cell lines were frequently tested for mycoplasma using MycoAlert Plus Mycoplasma Detection Kit (cat# LT07-218, Lonza).
-
bioRxiv - Cancer Biology 2022Quote: ... Cell lines were periodically tested to confirm Mycoplasma negativity using the MycoAlert mycoplasma Detection Kit (Lonza, Visp, Switzerland). Detailed methods for additional cell lines derived from solid tumors and leukemia are provided in Supplementary Materials and Methods.
-
bioRxiv - Immunology 2023Quote: Electroporation was performed to introduce siRNA into BMDCs using a mouse dendritic cell nucleofector kit (Lonza, Basel, Switzerland) and a Nucleofector 2b (Lonza) ...
-
bioRxiv - Molecular Biology 2023Quote: ... All cell lines were routinely tested for mycoplasma contamination by the MycoAlert Mycoplasma Detection Kit (Lonza #LT07-318).
-
bioRxiv - Developmental Biology 2023Quote: ... or pcDNA3.1(-) as a control using the AMAXA SG Cell line kit (4D-Nucleofector program EO-100; Lonza). Cells were further cultivated in DMEM/F12 supplemented with 10% FBS (Sigma ...
-
bioRxiv - Neuroscience 2023Quote: ... CRISPR reagents were transfected into iPSCs using the P3 Primary Cell 4D Nucleofector™ X Kit S (Lonza), as previously described (Deneault et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... and resuspended carefully in 20ul 4D-Nucleofector™ Solution (SE Cell Line 4D-Nucleofector™ X Kit, Lonza). Thereafter ...
-
bioRxiv - Immunology 2023Quote: ... The P14 cell/Cas9/RNP mixes were transferred to Nucleofection cuvette strips (4D-Nucleofector X kit S; Lonza). Cells were electroporated using a 4D nucleofector (4D-Nucleofector Core Unit ...
-
A spatially resolved EGFR signaling model predicts the length scale of GAB1-SHP2 complex persistencebioRxiv - Systems Biology 2023Quote: ... Cells were confirmed to be mycoplasma-negative using the MycoAlert Mycoplasma Detection Kit (LT07-318; Lonza, Basel, Switzerland).
-
bioRxiv - Cancer Biology 2023Quote: ... All cell lines were tested negative for mycoplasma contamination with MycoAlert® Mycoplasma Detection Kit (Lonza, LT07-118).
-
bioRxiv - Cell Biology 2023Quote: ... dermal fibroblasts were expanded and verified mycoplasm negative via MycoAlert™ PLUS Mycoplasma Detection Kit (Lonza, 75860-362) infected with Sendai virus containing Yamanaka factors from the CytoTune™-iPS 2.0 Sendai Reprogramming Kit (ThermoFisher ...
-
bioRxiv - Cell Biology 2023Quote: PC12 cells were transfected with 300 nM siRNA by electroporation using the Cell Line Nucleofector Kit V (Lonza), following the manufacturer’s instructions ...
-
Hallmark molecular and pathological features of POLG disease are recapitulated in cerebral organoidsbioRxiv - Cell Biology 2023Quote: ... Regular monitoring for mycoplasma contamination was performed using the Myco Alert™ Mycoplasma Detection Kit (Lonza, #LT07-218) to ensure the integrity of the cell lines.
-
bioRxiv - Immunology 2024Quote: ... 16.4µl P3 and 3.6µl Supplement Reaction solutions from P3 Primary Cell 4D X Kit S (Lonza V4XP-3032) were added ...
-
bioRxiv - Biochemistry 2023Quote: ... Cell lines were tested once a month for mycoplasma contamination using Mycoalert® Detection Kit (Lonza, Basel, Switzerland). MCF7 and MDA-468 cells were grown in RPMI 1640 medium (Thermo Fisher Scientific ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and Jurkat cell lines tested negative for mycoplasma with the MycoAlert Mycoplasma Detection Kit (Lonza Cat #LT07-318).
-
Vps18 contributes to phagosome membrane integrity in Mycobacterium tuberculosis-infected macrophagesbioRxiv - Microbiology 2023Quote: ... and nucleofection was performed as per the manufacturer’s recommendations (Lonza, SG Cell Line 4D-Nucleofector X Kit S). Monoclonal isolation of the knockouts were performed by limiting dilution ...
-
bioRxiv - Molecular Biology 2024Quote: ... iMEPM cells were tested for mycoplasma contamination using the MycoAlert Mycoplasma Detection Kit (Lonza Group Ltd, Basel, Switzerland). Packaged lentiviruses containing pLV[shRNA]-EGFP:T2A:Puro-U6>Scramble_shRNA (vectorID ...
-
bioRxiv - Neuroscience 2024Quote: ... we used the 4D-Nucleofector system and Amaxa P3 primary Cell 4D-Nucleofector X Kit S from Lonza. The electroporation buffer used was P3 primary cell Nucleofector Solution with Supplement 1 (Lonza) ...
-
bioRxiv - Molecular Biology 2024Quote: ... siRNA transfections were performed using the 4D-Nucleofector and the SE cell line 4D-Nucleofector X kits (Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... containing the appropriate guide RNA (gRNA) sequences (CGCTCAACTCGGCCATGCGC; GCAACAGATGGAAGGCCTCC) using the AmaxaTM nucleofectorTM kit V (Lonza #VCA-1003). Monoclonal lines were screened for puromycin sensitivity ...
-
bioRxiv - Developmental Biology 2021Quote: ... The resulting mixture was electrophoresed in NuSieve 3:1 agarose (Lonza 50091), and fragments sized 150-350 bp were excised and then purified using a MinElute Gel Extraction kit (QIAGEN 28604) ...
-
bioRxiv - Microbiology 2019Quote: ... and then 1 ml of SMEM complete medium [MEM Eagle Joklik (Lonza), 10% TBP ...
-
bioRxiv - Developmental Biology 2021Quote: ... sperm fraction was diluted 1:10 in Phosphate Buffered Saline (PBS, Lonza) and CellROX reagents (1 μM/μl ...
-
bioRxiv - Bioengineering 2020Quote: ... The cell suspension contained a 2:1 ratio of GFP-HUVECs (Lonza) and HDFs ...
-
bioRxiv - Cell Biology 2021Quote: ... 1×105 singularized cells were resuspended in 100μl of nucleofector solution (Lonza) containing 10 g of each sgRNA (#1 and #2 modified sgRNAs ...
-
bioRxiv - Developmental Biology 2022Quote: ... embryos and larvae were immobilized in 1% low-melting point agarose (Lonza) containing 0.016% tricaine and positioned in Fluoro-Dish glass bottom dishes (WorldPrecisition Instruments) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and QGP-1 cells were grown in RPMI 1640 (Lonza, Basel, Switzerland), both supplemented with 10 % fetal bovine serum (FBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... THP-1 cells and their derivatives were cultured in RPMI media (Lonza) supplemented with 10% FBS ...
-
bioRxiv - Cancer Biology 2020Quote: ... All media were supplemented with 1 mM sodium pyruvate (Lonza #BW13-115E), 2 mM L-glutamine (Gibco #25030081) ...
-
bioRxiv - Physiology 2020Quote: ... Digestion was stopped with 1 ml culture medium containing 80% DMEM (Lonza), 10% BCS (Hylcone) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and blocked for 1 h at RT in PBS (Lonza, Basel, Switzerland) containing 5% FBS and 0.2% Triton X-100 ...
-
bioRxiv - Microbiology 2021Quote: ... with 1% of L-Glutamine (200 mM) (Lonza Cat. No: BE17-605E), HCC-78 in RPMI-1640 (Sigma Cat ...
-
bioRxiv - Cell Biology 2020Quote: ... an additional erythrocyte lysis step with 1 ml ACK lysing buffer (Lonza) for 10 min ...
-
bioRxiv - Cell Biology 2020Quote: ... Cell lines were passaged with 1 × Trypsin-EDTA (Lonza, UK cat: T3924). All cell lines tested negative for Mycoplasma and all were authenticated in-house (CRUK-Manchester Institute ...
-
bioRxiv - Immunology 2021Quote: ... Cells were harvested on day 7 with 1 X PBS EDTA (Lonza).
-
bioRxiv - Immunology 2022Quote: ... 1×106 CD8+ T cells were re-suspended in P3 buffer (Lonza) containing RNP complex and enhancer DNA (IDT ...
-
bioRxiv - Microbiology 2022Quote: ... 1×104 HUVECs were cultured in EGM2 or dilution with EBM2 (Lonza). Apoptotic cells were stained with ViaStain Live Caspase 3/7 kit (Nexcelom ...
-
bioRxiv - Neuroscience 2022Quote: ... 1% v/v L-glutamine and penicillin/streptomycin (Lonza, cat# DE17-603E), at 37°C in 5% CO2.
-
bioRxiv - Molecular Biology 2023Quote: ... and 1% antibiotics (10000 U/ml penicillin, 10000 µg/ml streptomycin, Lonza). The cells were incubated in a humidified atmosphere at 37°C with 5% CO2.
-
bioRxiv - Cell Biology 2022Quote: ... 1 ug PX459 plasmid and blasticidin-expressing plasmid in Amaxa buffer (Lonza) with 100 mM ATP ...
-
bioRxiv - Cancer Biology 2023Quote: For USP18 KO LAPSE 1 × 106 cells were electroporated (Lonza, 4D-Nucleofactor) using the following electroporation buffers and protocols ...
-
bioRxiv - Microbiology 2023Quote: ... The RNA was loaded onto a 2% NuSieve 3:1 agarose (Lonza), 1X MOPS ...
-
bioRxiv - Microbiology 2023Quote: ... each 20 μL reaction contained 1X SYBR Green 1 (Lonza, Cat. # 50513), 1X Thermopol Reaction Buffer (NEB ...