Labshake search
Citations for Lonza :
2001 - 2050 of 2722 citations for Human Gap Junction Alpha 8 Protein CX50 GJA8 ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... HEK293T and HEK293T-ΔPTDSS1 tested negative for mycoplasma using the MycoAlert™ Mycoplasma Detection Kit (Lonza Bioscience). AC16 human cardiomyocyte cell line was purchased from Sigma Aldrich and cultured according to supplier specifications ...
-
bioRxiv - Bioengineering 2024Quote: ... Endothelial cell basal medium and endothelial cell growth factor kit were purchased from Lonza (Mount Waverley, Australia). Water (HPLC grade ...
-
bioRxiv - Cancer Biology 2024Quote: ... NPM1 wild-type OCI-AML2 and NPM1 mutant OCI-AML3 cells were nucleofected with 1µg Em_NPM_mut or Scar_NPM_wt constructs respectively using Nucleofector Kit-T (cat# VCA-1002, Lonza, Basel, Switzerland) with programme X-001 using a Nucleofector-2b device (Lonza) ...
-
bioRxiv - Cancer Biology 2024Quote: ... All cell lines were confirmed to be Mycoplasma negative using the MycoAlert Mycoplasma Detection Kit from Lonza according to the manufacturer’s instructions and used within 3 to 4 weeks from thawing ...
-
bioRxiv - Cancer Biology 2024Quote: ... and frequently checked for mycoplasma contamination using the MycoAlert Mycoplasma Detection Kit (cat. no. LT07-318, Lonza).
-
bioRxiv - Cancer Biology 2024Quote: All cell lines tested negative for mycoplasma using MycoAlert® Mycoplasma Detection Kit (Lonza Cat# LT07-318). Cell line identities were confirmed using short tandem repeat analysis (ATCC Cat# 135-XV).
-
bioRxiv - Genetics 2024Quote: For nucleofection of fibroblasts (2x10^6 cells per reaction) the P2 Primary Cell 4D-Nucleofector Kit (Lonza) was used ...
-
bioRxiv - Molecular Biology 2021Quote: ... and transfected using the Lonza Amaxa® Cell Line Nucleofector® Kit V (Lonza, Basel, Switzerland VCA-1003) using electroporation program A30 ...
-
bioRxiv - Immunology 2022Quote: ... 2×106 B cells were then nucleofected with 2 μg of plasmid DNA using Nucleofector Kit V (Lonza) and rested for at least 16-24 hours using complete media containing 5 ng/ml BAFF and lacking LPS ...
-
bioRxiv - Molecular Biology 2020Quote: ... This vector and the piggy bac transposase were then nucleofected into H9 using the AMAXA nucleofector kit (Lonza). Puromycin selection started 4 days following nucleofection and the surviving clones were screened by qPCR and Western Blot for NSUN6 expression ...
-
bioRxiv - Immunology 2021Quote: ... The P14 cell/Cas9/RNP mixes were transferred to Nucleofection cuvette strips (4D-Nucleofector X kit S; Lonza). Cells were electroporated using a 4D nucleofector (4D-Nucleofector Core Unit ...
-
bioRxiv - Neuroscience 2020Quote: ... All cell lines were tested for mycoplasma prior to experimental work using the MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Microbiology 2021Quote: ... All cell lines used in this report were routinely checked for mycoplasma contamination (MycoAlert Mycoplasma Detection Kit, Lonza) and were authenticated by the respective vendors ...
-
bioRxiv - Bioengineering 2021Quote: ... Cells were verified to be free of mycoplasma contamination using the MycoAlert Mycoplasma Detection Kit (Lonza, Allendale, NJ) and passaged when reaching 80% confluence.
-
bioRxiv - Cancer Biology 2021Quote: ... All cell lines were confirmed to be mycoplasma-free using the MycoAlert mycoplasma detection kit (Lonza: LT07-218).
-
bioRxiv - Cancer Biology 2020Quote: ... The presence of mycoplasma was tested for frequently in all cell lines with a MycoAlert kit (Lonza, Switzerland), exclusively using mycoplasma-free cells in all the experiments carried out.
-
Interactions with stromal cells promote a more oxidized cancer cell redox state in pancreatic tumorsbioRxiv - Cancer Biology 2020Quote: ... PDAC cells grown as 3D organoids were regularly tested for mycoplasma contamination using the MycoAlert Plus kit (Lonza) or the Mycoprobe Mycoplasma Detection Kit (R&D Systems).
-
bioRxiv - Cell Biology 2021Quote: ... The cell line were regularly tested for mycoplasma contamination by MycoAlert PLUS Mycoplasma Detection Kit (Lonza, LT07-703). Cells were transiently transfected with expression vectors using jetPRIME transfection reagent (Polyplus transfection ...
-
bioRxiv - Microbiology 2020Quote: ... Cell lines were monitored monthly to maintain mycoplasma-negative status using the MycoAlert Mycoplasma Detection Kit (Lonza, USA).
-
bioRxiv - Neuroscience 2021Quote: ... counted and 2×106 cells were transfected using the Basic Nucleofector kit for primary neurons (VAPI-1003, Lonza) and the D-33 programme on the Amaxa Nucleofector II B device (Amaxa Biosystems) ...
-
bioRxiv - Cancer Biology 2022Quote: ... All cells were screened – free from mycoplasma using MycoAlert™ Mycoplasma Detection kit (LT0-118, Lonza group Ltd.) and MycoAlert™ control set (LT07-518 ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 × 106 trypsinized cells were resuspended in 93.5 µl solution (mouse ES cell nucleofector kit, VPH-1001, Lonza). The solution includes 2 µg of each CRISPR/Cas9 vector (4 µg total ...
-
bioRxiv - Bioengineering 2022Quote: ... The iECs were cultured in endothelial cell growth medium 2 kit supplemented into basal media (except hydrocortisone, Lonza) with 1x GlutaMax (ThermoFisher ...
-
bioRxiv - Immunology 2020Quote: ... 1×106 cells per guide were electroporated with the corresponding RNP complex using Lonza Electroporation Kit V (Lonza). After 48 h ...
-
bioRxiv - Neuroscience 2021Quote: ... coated coverslips in a 24-well plate in 1ml Endothelial Growth Media-2 Bullet Kit (EGM-2; Lonza; Endothelial basal media-2 with 2% Fetal Bovine Serum (FBS) ...
-
bioRxiv - Microbiology 2020Quote: Electroporation was performed using the Amaxa P3 Primary Cell 96-well Nucleofector kit and 4D Nucleofector system (Lonza). Recombinant S ...
-
bioRxiv - Neuroscience 2021Quote: ... freshly isolated cortical neurons were transfected using the P3 Primary Cell 4D-Nucleofector Kit (Lonza, LZ-V4XP-3024) and the program DC-104 of the 4D-Nucleofector device (Lonza) ...
-
bioRxiv - Cell Biology 2021Quote: ... RNP was delivered by electroporation using a Lonza 4D-nucleofector and P3 Primary Cell Kit (Lonza, V4XP-3012). Cells were transferred to fresh StemSpan media and corresponding (AK2 or AAVS1 ...
-
bioRxiv - Genetics 2022Quote: ... were cultured in RtEGM with supplement medium as indicated by the manufacturer’s protocol (RtEGM bullet kit, Lonza, #00195409). HfRPE cells were cultured to high confluence on coverglass culture plates (Thermo ...
-
bioRxiv - Immunology 2022Quote: ... 1 x 10^6 purified naive T-cells were resuspended in 15µL buffer P3 + 5µL Supplement 1 (P3 Primary Cell 4D-NucleofectorTM X Kit S; Lonza) and mixed with 2.7µL RNP in the 16-well strips provided in the kit ...
-
bioRxiv - Pathology 2020Quote: ... Plasmid delivery through electroporation of passage three neurospheres was performed using Mouse neural stem cell nucleofector kit (Lonza).
-
bioRxiv - Cancer Biology 2020Quote: ... H2228 cells were electroporated with 3ug DRGFP substrate using reagent T (Amaxa Cell Line Nucleofector Kit T, Lonza), program X-001 on the Nucleofector 2b (Lonza) ...
-
bioRxiv - Microbiology 2020Quote: ... 1 million Jurkat T-cells were resuspended in 100 μL Nucleofector solution (Cell Line Nucleofector™ Kits, Lonza) and combined with 2 μg of the linearized dual-fluorophore vector and 2 μg of the corresponding gRNA/Cas9 plasmid ...
-
bioRxiv - Bioengineering 2021Quote: ... All cell lines were tested for mycoplasma every 3 months using MycoAlert Mycoplasma Detection Kit (Lonza, Basel, Switzerland). All cells used were <20 passages from thaw.
-
bioRxiv - Molecular Biology 2020Quote: ... Cells lines all tested negative for mycoplasma with the MycoAlter PLUS Mycoplasma Detection Kit (Lonza cat.#LT07-703). Lentivirus packaging was conducted at the Gene Vector and Virus Core of Stanford University or performed in-house using lentiviral constructs by co-transfection with ΔVPR ...
-
bioRxiv - Genomics 2021Quote: ... Cells were regularly passaged and tested for presence of mycoplasma contamination with MycoAlert Plus Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Genomics 2021Quote: ... K562 cells were grown to 1×106 and transfected with 1,000ng of gRNA plasmid and 3,000 ng of pCMV_AncBE4max_P2A_GFP (Amaxa® Cell Line Nucleofector® Kit V, Lonza). K562 cells were cultured for an additional 48 hours then single clones of green cells were isolated using flow cytometry (Aria II) ...
-
bioRxiv - Molecular Biology 2020Quote: ... using the Cell Line Nucelofector Kit V and the Amaxa Nucleofector II Device (Lonza Group AG, Basel, CH). Stable cells were selected for with 1mg/mL hygromycin B (Invitrogen ...
-
bioRxiv - Cancer Biology 2021Quote: ... fixed after 12 days and stained according to the OsteoImage™ Mineralisation Assay Lonza kit (PA-1503, Lonza) protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... EB3-mCherry construct (Stepanova et al., 2003) was transiently transfected using Amaxa Cell Line Nucleofector kit V (Lonza), program X-001.
-
bioRxiv - Cell Biology 2020Quote: ... Both cell lines were regularly tested for mycoplasma contamination by MycoAlert PLUS Mycoplasma Detection Kit (Lonza, LT07-703). REF52 cells were transiently transfected with mEos3.2-Actin expression vector (Michael W ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cell lines were periodically tested to confirm Mycoplasma negativity using the MycoAlert mycoplasma Detection Kit (Lonza, Visp, Switzerland). Detailed methods for additional cell lines derived from solid tumors and leukemia are provided in Supplementary Materials and Methods.
-
bioRxiv - Immunology 2023Quote: Electroporation was performed to introduce siRNA into BMDCs using a mouse dendritic cell nucleofector kit (Lonza, Basel, Switzerland) and a Nucleofector 2b (Lonza) ...
-
bioRxiv - Microbiology 2023Quote: ... Parasites and host cells were regularly tested for Mycoplasma contamination using the Mycoalert detection kit (Lonza; Basel, Switzerland). For all assays ...
-
bioRxiv - Molecular Biology 2023Quote: ... All cell lines were frequently tested for mycoplasma using MycoAlert Plus Mycoplasma Detection Kit (cat# LT07-218, Lonza).
-
bioRxiv - Cancer Biology 2023Quote: ... All cell lines were tested negative for mycoplasma contamination with MycoAlert® Mycoplasma Detection Kit (Lonza, LT07-118).
-
bioRxiv - Molecular Biology 2023Quote: ... All cell lines were routinely tested for mycoplasma contamination by the MycoAlert Mycoplasma Detection Kit (Lonza #LT07-318).
-
bioRxiv - Developmental Biology 2023Quote: ... or pcDNA3.1(-) as a control using the AMAXA SG Cell line kit (4D-Nucleofector program EO-100; Lonza). Cells were further cultivated in DMEM/F12 supplemented with 10% FBS (Sigma ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Cultures were confirmed to be free of mycoplasma infection using the MycoAlert Mycoplasma Detection Kit (Lonza, Walkersville, MD). Briefly ...
-
bioRxiv - Cell Biology 2024Quote: ... containing the appropriate guide RNA (gRNA) sequences (CGCTCAACTCGGCCATGCGC; GCAACAGATGGAAGGCCTCC) using the AmaxaTM nucleofectorTM kit V (Lonza #VCA-1003). Monoclonal lines were screened for puromycin sensitivity ...