Labshake search
Citations for Lonza :
2001 - 2050 of 2917 citations for 2' 3' cGAMP STING based FRET Detection Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... Using Amaxa SF Cell Line 4D-Nucleofector X Kit (Lonza), WT HEK293T cells were transfected with a transposase-encoding plasmid (pSB100X) ...
-
bioRxiv - Systems Biology 2023Quote: ... and Mouse Embryonic Stem Cell NucleofectorTM Kit (#VPH-1001, Lonza). Three biological replicates were performed per library on different days ...
-
Chromatin priming elements direct tissue-specific gene activity prior to hematopoietic specificationbioRxiv - Genomics 2023Quote: ... with the P3 Primary Cell X kit (Lonza, V4XP-3024). ES cells clones were picked and screened for successful homologus CRISPR by PCR using primers designed outside of the CRISPR guide region (AAGGCTGTCTAGCACTCGTT ...
-
bioRxiv - Neuroscience 2023Quote: ... using the P3 Primary Cell nucleofector kit (Lonza, V4XP-3012). 8×105 cells were resuspended in 100µl P3 solution ...
-
bioRxiv - Bioengineering 2023Quote: ... SE and P3 Cell Line 4D-Nucleofector X Kit (Lonza) was used as the nucleofection agent following the manufacturer’s protocol ...
-
Cancer-associated fibroblasts produce matrix-bound vesicles that influence endothelial cell functionbioRxiv - Cancer Biology 2023Quote: Transient knockdown was performed using the Amaxa kit R (Lonza) and Nucleofector device (program T-20 ...
-
bioRxiv - Cell Biology 2023Quote: Nucleofection was performed using the Amaxa MEF2 Nucleofector Kit (Lonza) following the manufecturer’s suggested protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... and gentamicin/amphotericin (Single Quots® kit, CC‒4127, Lonza), pH 7.40 ...
-
bioRxiv - Bioengineering 2023Quote: ... and Amaxa Human CD34+ Cell Nucleofector kit (Lonza, Basel, Switzerland) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... With the mouse ES Cell Nucleofector Kit (Lonza VPH-1001), PiggyBAC and pBASE plasmid are co-transfected into mESCs ...
-
bioRxiv - Cancer Biology 2023Quote: ... UWB1.289PT in the 50% RPMI-1640 (Gibco™)/ 50% MEGM (MEGM Bullet Kit; CC-3150, Lonza, Basel, Switzerland) supplemented with 3% FBS ...
-
bioRxiv - Cell Biology 2024Quote: ... in combination with the P3 Primary Cell Buffer Kit (Lonza). Per sample ...
-
bioRxiv - Genetics 2024Quote: ... and SF Cell Line 4D X Kit (Lonza, #V4XC-2024) were employed ...
-
bioRxiv - Immunology 2023Quote: ... using a mouse T cell nucleofection kit (Lonza, VPA-1006), and rested overnight in R10 medium ...
-
bioRxiv - Immunology 2024Quote: ... were nucleofected using P3 Primary cell 4D-nucleofection kit (Lonza) and DN100 pulse on 4D nucleofector X unit (Lonza) ...
-
bioRxiv - Cell Biology 2024Quote: ... and the Cell line Nucleofector Kit T (Lonza, VCA-1002) were used for the plasmids cells transfections (1-5 µg) ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were electroporated with either CFP-IRES or RBP-IRES-CFP vector (5 µg) using a 4D-Nucleofector (Lonza, program DS-112) in 16-well stripes (500,000 cells/well ...
-
bioRxiv - Systems Biology 2020Quote: Single-cell suspensions were pelleted at 400 x g for 5 min and washed once with 10 mL mammary epithelial basal medium (MEBM; Lonza CC-3151). For each sample ...
-
bioRxiv - Biophysics 2021Quote: ... ATCC-CRL 10317) were grown at 37°C and 5% CO2 in Mammary Epithelial Cell Growth Basal medium (MEBM from Lonza Pharma & Biotech), supplemented with 5% Horse Serum (HS ...
-
bioRxiv - Microbiology 2021Quote: ... Recovered cells were further depleted of red blood cells by resuspending cells with 5-ml of AKC lysis buffer (Lonza, Walkersville, MD). Following 5 min incubation at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... all cells were cultured at 37°C in a humidified 5% CO2 incubator in minimum essential medium Eagle α (Lonza; BE12-169F) supplemented with 10% (v/v ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were transduced with Adenovirus-GFP (AV-Gfp) or Adenovirus-mHilpda (AV-Hilpda) at 5 × 106 IFU/mL media in DMEM (Lonza, Verviers, Belgium) supplemented with 10% fetal calf serum (Lonza ...
-
bioRxiv - Cell Biology 2021Quote: ... and cells were isolated by centrifugation at 500 g for 5 min at 4°C followed by being treated with ACK Lysing Buffer (10-548E, Lonza Bioscience, Switzerland) to remove red blood cells ...
-
bioRxiv - Microbiology 2022Quote: ... schizonts purified from an overnight culture of PbDiCre parasites were transfected with 5–10 µg of linearised plasmid by electroporation using the AMAXA Nucleofector device (Lonza, program U033), as previously described (Janse et al. ...
-
bioRxiv - Immunology 2022Quote: ... 5×106 cells were mixed with RNPs and transferred without forming bubbles to a 16-well Nucleocuvette© Strip (Lonza, V4XP-3032). Unless otherwise stated ...
-
bioRxiv - Immunology 2019Quote: ... were sorted into B cell media (IMDM medium, GIBCO; 10% heat-inactivated low IgG FBS, Life Technologies; 5 ml GlutaMAX, Life Technologies; 1 ml MycoZap plus PR, Lonza). Immediately following the sort ...
-
bioRxiv - Molecular Biology 2020Quote: ... The dissociated cell suspension was cultured on rat tail collagen type I-coated dishes at 37 °C in 5% CO2 using Small Airway Epithelial Cell Growth Medium (SAGM; basal medium plus growth supplements, Lonza, CC-3118) containing 1% AA ...
-
bioRxiv - Cell Biology 2020Quote: ... NIH 3T3 and immortalized MVD7 cells were cultured at 37°C and 5% CO2 in high glucose DMEM culture medium (Lonza, Cologne, Germany) supplemented with 10% FBS (Biowest) ...
-
bioRxiv - Immunology 2021Quote: ... NIH AIDS Research and Reference Reagent Program) were grown at 37°C in a humidified atmosphere with 5% CO2 in RPMI 1640 medium (Lonza, Verviers, Belgium) in the case of the CEM.NKR-CCR5 cells ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells lines were maintained in humidified 37°C the incubator with 5% CO2 and routinely tested for mycoplasma contamination (Lonza #LT07-118).
-
bioRxiv - Cell Biology 2022Quote: ... The cells obtained were cultured in complete medium (DMEM-F12, penicillin-streptomycin, L-glutamine, nonessential aminoacids, sodium pyruvate, all Gibco, Monza, Italy and 5% FBS, Lonza, Milan, Italy). Lung adenocarcinoma A549 was purchased by ATCC and cultured in DMEM-F12 supplemented with 10% FBS (All Gibco) ...
-
bioRxiv - Bioengineering 2022Quote: ... Hydrogels were fabricated using a solution consisting of lyophilized GelMA (5 wt%) dissolved at 37°C in phosphate buffered saline (PBS; Lonza 17-516F) and combined with 0.1% w/v lithium acylphosphinate (LAP ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cell lines were maintained at 37°C in a humidified incubator containing 95% air and 5% CO2 and routinely tested for mycoplasma contamination with the MycoAlert Assay (Lonza, LT07-418). For experiments requiring manipulation of cystine availability ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells lines were maintained in a humidified 37°C incubator with 5% CO2 and routinely tested for mycoplasma contamination (Lonza #LT07-118).
-
bioRxiv - Neuroscience 2023Quote: ... Cells were electroporated at 5 million cells/100 mL cells per cuvette using a Lonza 4-D nucleofector with pulsecode DP-148 (Lonza, VVPA-1002). Cells were co-cultured for 5 additional days with human astrocyte before transferring cells to homeostatic culture conditions (MGdM media ...
-
bioRxiv - Genomics 2023Quote: The AIDA Data Freeze v1 gene-cell matrix (1,058,909 cells from 503 Japan, Singaporean Chinese, Singaporean Malay, Singaporean Indian, and South Korea Asian donors and 5 distinct Lonza commercial controls), with BCR-seq and TCR-seq metadata ...
-
bioRxiv - Genomics 2023Quote: ... were washed twice with PBS and resuspended in a solution containing a 4.5:5 mixture of nucleofection buffer (Buffer SE, Lonza Lot #: S-09279) and supplement (Lonza ...
-
bioRxiv - Microbiology 2024Quote: ... 5 million parasites were electroporated with 5-10ug of digested plasmid with an AMAXA Nucleofector II using X-001 in Human T-cell Nucleofector Solution (Lonza VPA-1002).
-
bioRxiv - Biochemistry 2024Quote: ... All the cells were maintained in a humidified incubator with 5% CO2 at 37 °C and tested negative for mycoplasma by MycoAlert (Lonza, Morristown, NJ). Cells from passage 14-15 (P14-15 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The product was purified and 2 µg were added to the RNP and diluted in 100 µL P3 nucleofection buffer (Lonza). This mixture was nucleofected with 2×106 stimulated human primary T cells using the 4D-Nucleofector (Lonza ...
-
bioRxiv - Biochemistry 2019Quote: ... Sf21 cells (2 × 106 cells mL−1) were infected with the P3 viral stock in Insect-XPRESS protein-free medium (Lonza). The infected insect cells were grown at 27 °C with shaking for 66 hours ...
-
bioRxiv - Developmental Biology 2020Quote: ... The red blood cell lysis was performed by resuspending the pellet in 2 ml sterile ACK (Ammonium-Chloride-Potassium) lysis buffer (ACK Lysing Buffer, Lonza) and incubating on ice for 5 minutes ...
-
bioRxiv - Cancer Biology 2019Quote: ... Human cerebral microvascular endothelial cells (hCMEC/D3 [hCMEC]; gift from Dr. B. Weksler, Cornell Medical College) were grown in endothelial basal medium-2 (Lonza) supplemented with 5% FBS ...
-
bioRxiv - Cell Biology 2019Quote: ... were isolated from neonatal foreskin and cultured on 0.1% gelatin-coated culture dishes in 0.1% gelatin-coated culture dishes in EGM-2 MV media (Lonza #cc-3202). Both HUVEC and MEC were used before passage five in all experiments and the endothelial identity of the cells was confirmed by immunofluorescence microscopy with antibodies to endothelial markers PECAM-1 and VE-cadherin.
-
bioRxiv - Genomics 2021Quote: ... two million H9 hESCs were co-electroporated with the appropriate knockin vector (5 μg) and plasmids encoding AAVS1-targeting TALENs (2 μg; addgene, 59025 and 59026) using an Amaxa 4D Nucleofector system (Lonza). Serial cell dilutions were then seeded in six-well plates in E8 supplemented with Y-27632 (10 μM) ...
-
bioRxiv - Bioengineering 2021Quote: ... The hCMEC/D3 cells were cultured in complete media composed of endothelial cell basal medium-2 (Lonza Walkersville Inc., MD), supplemented with 5% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2020Quote: ... were resuspended at a density of 6×106 cells mL−1 in Microvascular Endothelial Cell Growth Medium-2 media (EGM-2MV, Lonza). The bottom channel of the chip was washed with EGM-2MV and loaded with 6 μL of HIMEC cell suspension (~36,000 cells per chip) ...
-
bioRxiv - Cell Biology 2020Quote: ... aliquots of obtained BM aspirates were seeded into cell culture flasks containing endothelial basal media (EBM-2, Lonza, Cologne, Germany) supplemented with 10% human platelet lysate (PL ...
-
bioRxiv - Bioengineering 2022Quote: ... Human hepatic stellate cell LX-2 was cultured in HEPES-buffered Dulbecco’s modified Eagle medium (DMEM) (Lonza BioWhittaker, Verviers, Belgium) supplemented with 4 mmol/L L-glutamine (Lonza) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and E15.5 (n=2–6) Six2-TROMA-1 stained kidneys were embedded in 1 % low melting agar (50100; Lonza Group). The lateral cortex of the kidneys was imaged with a Nikon A1R MP+ multiphoton microscope (Tokyo ...