Labshake search
Citations for Lonza :
1951 - 2000 of 2633 citations for Human Bcl2 Associated Death Promoter BAD ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... All cell lines were regularly tested for mycoplasma contamination using a biochemical test kit (#LT07-318, Lonza, Switzerland) and were free of mycoplasma contamination.
-
bioRxiv - Cell Biology 2022Quote: ... 25 μg mRNA was transfected into 2.5 × 106 freshly thawed fibroblasts using Cell Line Nucleofector Kit V (Lonza) and AMAXA program X-001 following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Transient transfections of these dominant-negative Rab11 a and siRab11 a into mouse MΦs (RAW 264.7 cell line) were performed with Amaxa mouse macrophage nucleofector kit (VPA-1009, Lonza) and DharmaFECT 4 Transfection Reagent (T-2004-01 ...
-
bioRxiv - Cell Biology 2022Quote: ... All cell lines were routinely tested for mycoplasma contamination by using the MycoAlert PLUS Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Cultures were confirmed to be free of mycoplasma infection using the MycoAlert Mycoplasma Detection Kit (Lonza, Walkersville, MD). Briefly ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and Jurkat cell lines tested negative for mycoplasma with the MycoAlert Mycoplasma Detection Kit (Lonza Cat #LT07-318).
-
bioRxiv - Immunology 2023Quote: ... 1×10e6 cells per guide were electroporated with the corresponding RNP complex using Lonza Electroporation Kit V (Lonza). After 48 h ...
-
Vps18 contributes to phagosome membrane integrity in Mycobacterium tuberculosis-infected macrophagesbioRxiv - Microbiology 2023Quote: ... and nucleofection was performed as per the manufacturer’s recommendations (Lonza, SG Cell Line 4D-Nucleofector X Kit S). Monoclonal isolation of the knockouts were performed by limiting dilution ...
-
bioRxiv - Neuroscience 2024Quote: ... we used the 4D-Nucleofector system and Amaxa P3 primary Cell 4D-Nucleofector X Kit S from Lonza. The electroporation buffer used was P3 primary cell Nucleofector Solution with Supplement 1 (Lonza) ...
-
bioRxiv - Cell Biology 2024Quote: ... containing the appropriate guide RNA (gRNA) sequences (CGCTCAACTCGGCCATGCGC; GCAACAGATGGAAGGCCTCC) using the AmaxaTM nucleofectorTM kit V (Lonza #VCA-1003). Monoclonal lines were screened for puromycin sensitivity ...
-
bioRxiv - Immunology 2024Quote: ... 1 - 2.5 × 106 Jurkat T cells were resuspended in EP buffer from the Nucleofector® Kit V (Lonza). Cells were combined with 1.5 μg of donor plasmid in a reaction volume of 100 μL and electroporated on the Amaxa® Nucleofector® II using pulse code X-005.
-
bioRxiv - Immunology 2024Quote: ... 16.4µl P3 and 3.6µl Supplement Reaction solutions from P3 Primary Cell 4D X Kit S (Lonza V4XP-3032) were added ...
-
bioRxiv - Biochemistry 2023Quote: ... Cell lines were tested once a month for mycoplasma contamination using Mycoalert® Detection Kit (Lonza, Basel, Switzerland). MCF7 and MDA-468 cells were grown in RPMI 1640 medium (Thermo Fisher Scientific ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 1 × 106 HEK293T cells were transfected using SF Cell Line 4D-NucleofectorTM X Kit S (Lonza, V4XC-2012) with 7 µg of 5’ modified donor ...
-
bioRxiv - Molecular Biology 2024Quote: ... siRNA transfections were performed using the 4D-Nucleofector and the SE cell line 4D-Nucleofector X kits (Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Parasites and host cells were regularly tested for Mycoplasma contamination using the Mycoalert detection kit (Lonza; Basel, Switzerland). For all assays ...
-
bioRxiv - Molecular Biology 2023Quote: ... All cell lines were frequently tested for mycoplasma using MycoAlert Plus Mycoplasma Detection Kit (cat# LT07-218, Lonza).
-
bioRxiv - Cancer Biology 2022Quote: ... Cell lines were periodically tested to confirm Mycoplasma negativity using the MycoAlert mycoplasma Detection Kit (Lonza, Visp, Switzerland). Detailed methods for additional cell lines derived from solid tumors and leukemia are provided in Supplementary Materials and Methods.
-
bioRxiv - Immunology 2023Quote: Electroporation was performed to introduce siRNA into BMDCs using a mouse dendritic cell nucleofector kit (Lonza, Basel, Switzerland) and a Nucleofector 2b (Lonza) ...
-
bioRxiv - Molecular Biology 2023Quote: ... All cell lines were routinely tested for mycoplasma contamination by the MycoAlert Mycoplasma Detection Kit (Lonza #LT07-318).
-
bioRxiv - Developmental Biology 2023Quote: ... or pcDNA3.1(-) as a control using the AMAXA SG Cell line kit (4D-Nucleofector program EO-100; Lonza). Cells were further cultivated in DMEM/F12 supplemented with 10% FBS (Sigma ...
-
bioRxiv - Neuroscience 2023Quote: ... CRISPR reagents were transfected into iPSCs using the P3 Primary Cell 4D Nucleofector™ X Kit S (Lonza), as previously described (Deneault et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... and resuspended carefully in 20ul 4D-Nucleofector™ Solution (SE Cell Line 4D-Nucleofector™ X Kit, Lonza). Thereafter ...
-
A spatially resolved EGFR signaling model predicts the length scale of GAB1-SHP2 complex persistencebioRxiv - Systems Biology 2023Quote: ... Cells were confirmed to be mycoplasma-negative using the MycoAlert Mycoplasma Detection Kit (LT07-318; Lonza, Basel, Switzerland).
-
bioRxiv - Cancer Biology 2023Quote: ... All cell lines were tested negative for mycoplasma contamination with MycoAlert® Mycoplasma Detection Kit (Lonza, LT07-118).
-
bioRxiv - Cell Biology 2023Quote: ... dermal fibroblasts were expanded and verified mycoplasm negative via MycoAlert™ PLUS Mycoplasma Detection Kit (Lonza, 75860-362) infected with Sendai virus containing Yamanaka factors from the CytoTune™-iPS 2.0 Sendai Reprogramming Kit (ThermoFisher ...
-
Hallmark molecular and pathological features of POLG disease are recapitulated in cerebral organoidsbioRxiv - Cell Biology 2023Quote: ... Regular monitoring for mycoplasma contamination was performed using the Myco Alert™ Mycoplasma Detection Kit (Lonza, #LT07-218) to ensure the integrity of the cell lines.
-
bioRxiv - Cancer Biology 2024Quote: ... Absence of Mycoplasma contamination was determined at every plating using the MycoAlert kit according to manufacturer’s instructions (Lonza). Cell lines were cultured in 5% CO2 in a humidified atmosphere in 37°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... Possible mycoplasma contamination was routinely monitored across all cell lines using the MycoAlert detection Kit (Lonza; LT07-318).
-
bioRxiv - Biochemistry 2024Quote: ... 3×105 cells were electroporated using P3 Primary Cell Nucleofector® 4D Kit and Nucleofector 4D system (Lonza) with 400 ng donor DNA ...
-
bioRxiv - Bioengineering 2024Quote: ... in a strip format using SF Cell Line 4D-Nucleofector™ X Kit S (Lonza, Cat# V4XC-2032). Purified PEs and CODEs were complexed with either pegRNA or cpegRNA to form RNP at 50 pmol protein ...
-
bioRxiv - Immunology 2024Quote: ... NU-DHL1 cells were transfected using the SG Cell Line 4D-Nucleofector™ X Kit V4XC-3024 (Lonza) with the DS-104 setting.
-
bioRxiv - Molecular Biology 2024Quote: ... and were routinely determined to be negative for Mycoplasma infection using a MycoALert detection kit (Lonza #LT07-118).
-
bioRxiv - Cell Biology 2024Quote: ... HeLa cells were electroporated using the Amaxa system with the nucleofection kit Cat No VCA-1003 from Lonza. Cells were FACS-sorted into 96-well plates to obtain single-cell derived colonies carrying the INDEL mutations ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lines were regularly tested for mycoplasma contamination using the MycoAlert PLUS Mycoplasma Detection Kit (Lonza BioSciences, LT07-710). All cells were cultured in a Heracell humidified incubator (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... The P14 cell/Cas9/RNP mixes were transferred to Nucleofection cuvette strips (4D-Nucleofector X kit S; Lonza). Cells were electroporated using a 4D nucleofector (4D-Nucleofector Core Unit ...
-
bioRxiv - Immunology 2024Quote: ... All cells were confirmed to be negative for mycoplasma contamination as assessed by MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Immunology 2024Quote: ... 1×106 cells per guide were electroporated with the corresponding RNP complex using Lonza Electroporation Kit V (Lonza). After 48 h ...
-
bioRxiv - Bioengineering 2024Quote: ... were co-transfected with 2 µg plasmid-expressing guide RNA using a stem cell nucleofector kit (Lonza, Amaxa). Multiple guide RNAs were used to generate a collection of isogenic mutant cell lines ...
-
bioRxiv - Cancer Biology 2024Quote: ... following a previously established and published protocol 123 or use of the MycoAlert PLUS Mycoplasma Detection Kit (Lonza). Only mycoplasma-negative cells were used.
-
bioRxiv - Cancer Biology 2024Quote: ... The media is comprised of small airway basal media (SABM) with selected components from SAGM bullet kit (Lonza) including Insulin ...
-
bioRxiv - Bioengineering 2024Quote: The absence of mycoplasma contamination was regularly checked with the MycoAlert PLUS Mycoplasma Detection Kit (Lonza, Visp, Switzerland).
-
bioRxiv - Cancer Biology 2024Quote: ... Mycoplasma infection of cell lines was regularly checked for by using Mycoalert® Detection Kit (Lonza, Basel, Switzerland). Cells grown in an incubator at 37⁰C and 5% CO2.
-
bioRxiv - Cancer Biology 2024Quote: ... All cell lines were routinely tested for mycoplasma contamination by using the MycoAlert PLUS Mycoplasma Detection Kit (Lonza). Cell viability was assessed using Trypan Blue Solution ...
-
bioRxiv - Cancer Biology 2024Quote: ... The cell culture was checked for mycoplasma contamination with the MycoAlert® Mycoplasma Detection Kit (LT07-118, Lonza) according to the manufacturer’s guidelines ...
-
bioRxiv - Cell Biology 2024Quote: ... Cas9–sgRNA–RNP electroporation was conducted with the Amaxa P3 Primary Cell 96-well 4D-Nucleofector Kit (Lonza). The safe harbor T cells were targeted using the AAVS1 sequence GGGCCACTAGGGACAGGAT ...
-
bioRxiv - Cell Biology 2024Quote: ... and electroporated with plasmids for gene activation using P3 Primary Cell 4D-Nucleofector X Kit (Lonza V4XP-3032). The reactions were performed using the “CB-150” program on the Lonza 4D-Nucleofector X Unit ...
-
bioRxiv - Genetics 2024Quote: PHA-L-stimulated PBMCs (2.0-2.5x10^7 cells per reaction) were nucleofected with the P3 Primary Cell 4D-Nucleofector Kit (Lonza). After application of program EO-115 ...
-
bioRxiv - Cell Biology 2020Quote: ... or a FOXO1-targeted siRNA (GAGCGUGCCCUACUUCAAGGA) using the Amaxa(tm) Basic Nucleofector(tm) Kit for Primary Mammalian Fibroblasts (Lonza), according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... Two million WTC iPSC were nucleofected using an Amaxa nucleofector 2B and the Nucleofector Kit C (both from Lonza), 0.5 µg of each AAVS1 TALEN pair and 1 µg of the donor plasmid (see Figure S4) ...