Labshake search
Citations for Lonza :
151 - 200 of 381 citations for pIEXBac c EGFP 3 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: Spinner adapted murine L929 (L) cells were grown at 37°C in Joklik’s minimal essential medium (Lonza) supplemented with 5% fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2020Quote: ... Swabs were stored at −80 °C in transport medium (Minimum Essential Medium Eagle with Hank's BSS (Lonza), 5 g L−1 lactalbumine enzymatic hydrolysate ...
-
bioRxiv - Systems Biology 2024Quote: ... cultured cells were washed by dispensing and aspirating 37°C HEPES buffered saline solution (Lonza, CC-5022) and then dissociated with 0.025% Trypsin/EDTA (Lonza ...
-
bioRxiv - Microbiology 2024Quote: ... of 0.01 and incubated at 37 °C for 5-6 days in Dulbecco’s modified Eagle’s medium (DMEM; Lonza) with 2% FBS (Sigma-Aldrich) ...
-
bioRxiv - Bioengineering 2023Quote: ... in passages 5-8 were cultured at 37°C and 5% CO2 in EGM2 cell medium (Lonza). Cells were detached from the adhering surface using TrypLE (Life Technologies ...
-
bioRxiv - Biochemistry 2021Quote: ∼300 pairs of ovaries per replicate were harvested from 3-6 day old females in 1X PBS (Lonza) with 1 mM DTT (Sigma ...
-
bioRxiv - Bioengineering 2021Quote: ... All cell lines were tested for mycoplasma every 3 months using MycoAlert Mycoplasma Detection Kit (Lonza, Basel, Switzerland). All cells used were <20 passages from thaw.
-
bioRxiv - Immunology 2021Quote: ... and suspended at a concentration of 3 × 106cells/mL in RPMI-1640 (BioWhittaker®, Lonza, Walkersville, MD, USA) containing 15% heat-inactivated horse serum ...
-
bioRxiv - Molecular Biology 2021Quote: Inguinal white adipose tissue from 3-4 WT-C57Bl/6 male mice was collected and placed in Dulbecco’s modified eagle’s medium (DMEM; Lonza) supplemented with 1% Penicillin/Streptomycin (PS ...
-
bioRxiv - Microbiology 2021Quote: ... The human lung epithelial cell line Calu-3 (ATCC HTB-55) was maintained in DMEM F-12 (Lonza) supplemented with 10% FBS ...
-
bioRxiv - Neuroscience 2022Quote: ... Electrophoresis of 10 µl of RT-PCR products was performed using 3% agarose (SeaKem LE Agarose by Lonza) with molecular ladder gel containing 0.5 µg/ml ethidium bromide in x0.5 tris-acetate-ethylenediaminetetraacetic acid (TAE ...
-
bioRxiv - Cell Biology 2023Quote: Bone marrow derived DCs at day 7 (3×106) were transfected with 100μl of the Amaxa solution (Lonza) containing siRNA (control or target-specific ...
-
bioRxiv - Immunology 2023Quote: ... beads were removed on day 3 followed by electroporation using the Human T Cell Nucleofector™ Kit (Lonza) and the Amaxa Nucleofactor® 2b (Lonza ...
-
bioRxiv - Cell Biology 2023Quote: For immunoprecipitations performed on THP-1 cells were first transfected with 2 μg of empty vector pCDNA 3.1 or plasmid containing 3x FLAG_Vamp-3 using the Amaxa 4D nucleoporator system (Lonza) with the Amaxa SG Cell line kit and program FF-100 and following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... All cell lines were cultured less than 3 months after resuscitation and tested for contaminants using MycoAlert (Lonza) every 1-3 months to ensure they were free of Mycoplasma contamination.
-
bioRxiv - Biochemistry 2024Quote: ... 3×105 cells were electroporated using P3 Primary Cell Nucleofector® 4D Kit and Nucleofector 4D system (Lonza) with 400 ng donor DNA ...
-
bioRxiv - Microbiology 2024Quote: ... and sporozoites were collected by centrifugation at 2,500 rpm for 3 min and resuspended in SF buffer (Lonza) containing 50 mg of tagging plasmid or 30 mg of linear targeting template and 30 mg CRISPR/Cas9 plasmid in a total volume of 100 ml ...
-
bioRxiv - Cancer Biology 2021Quote: ... It was grown at 37°C in 5% CO2 in Eagle’s Minimum Essential Medium (EMEM, Lonza, Allendale, NJ) supplemented with 10% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2022Quote: ... Thawed PBMCS were rested overnight at 37 °C in X-VIVO 15 Serum-free Hematopoietic Cell Medium (Lonza) supplemented with 5% human Ab serum ...
-
bioRxiv - Molecular Biology 2021Quote: Human and mouse fibroblasts were cultured at 37°C and 5% CO2 in Dulbecco’s modified Eagle’s medium (Lonza) with high glucose supplemented with 10% foetal bovine serum ...
-
bioRxiv - Cell Biology 2022Quote: ... were cultivated at 37°C with 5% CO2 in DMEM (Dulbecco’s Modified Eagle’s Medium, Lonza Cat. #BE12-614F) with 10% fetal bovine serum albumin (Gibco ...
-
bioRxiv - Cell Biology 2020Quote: ... and HEK293 cells expressing mouse TRPV2 in a stable manner were grown at 37 °C with a 5% CO2 humidified atmosphere in Dulbecco’s Modified Eagle’s Medium (DMEM, Lonza). The DMEM was supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Molecular Biology 2024Quote: ... were incubated at 37°C in a 5% CO2 humidified atmosphere and propagated in Dulbecco’s modified Eagle’s medium (DMEM; Lonza) supplemented with 10% fetal bovine serum ...
-
bioRxiv - Biochemistry 2023Quote: ... Briefly, D.mel-2 cells (CRL-1963, ATCC) were grown at 25°C in Insect-Xpress medium (181562, Lonza) supplemented with 1% Pen/Strep (15140122 ...
-
bioRxiv - Biochemistry 2023Quote: ... were incubated at 37°C in a 5% CO2 humidified atmosphere and propagated in Dulbecco’s modified Eagle’s medium (DMEM; Lonza) supplemented with 10% fetal bovine serum ...
-
bioRxiv - Genetics 2023Quote: ... 2−106 lymphoblastoid cells were suspended in 100 μL of Nucleofector C solution (VCA-1004, Lonza Cologne AG) with 0.6 μM RNAi and transfected with the Z-001 program according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were stored in humidified incubators at 37 °C with 5% CO2 and routinely checked for mycoplasma (Lonza).
-
bioRxiv - Cell Biology 2023Quote: Human mammary epithelial cells (HMECs) were cultured at 37°C with 5% CO2 in MEBM basal medium (Lonza) supplemented with MEGM SingleQuots (Lonza ...
-
bioRxiv - Bioengineering 2024Quote: ... Insect Drosophila melanogaster Schneider S2 cells were cultivated at 26°C in Insect-XPRESS media (Lonza, Basel, Switzerland) supplemented with 2 mM L-glutamine.
-
bioRxiv - Microbiology 2024Quote: ... Human umbilical endothelial cells (HUVEC-C; ATCC, CRL-1730) were cultured in Lonza EGM-Plus (Lonza, CC-4542) supplemented with bullet kit (Lonza ...
-
bioRxiv - Neuroscience 2021Quote: ... Tissues were washed 3-4 times over 1 hour in PBS (calcium- and magnesium-free; Lonza BioWhittaker #17-517Q) containing 0.1% Triton X-100 (PBT ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA directed against Dsg1 (Integrated DNA Technologies) with a targeting sequence 5′-CCATTAGAGAGTGGCAATAGGATGA-3′ using Amaxa Nucleofector System (Lonza) for electroporation of cells according to manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2022Quote: ... 3 µL of the sgRNA (total 300 pmol) was added to 12 µL of SE buffer (Lonza V4XC-1032). In another well ...
-
bioRxiv - Biochemistry 2021Quote: ... For each nucleofection 3 x 106 cells were resuspended in 80 μl of mouse ES cell nucleofection solution (Lonza). Equimolar (0.32 nmol ...
-
bioRxiv - Cancer Biology 2020Quote: ... were used in passages 3-6 and cultured on 0.1% gelatin-coated tissue culture plates in complete EGM2 (Lonza) supplemented to a total of 10% Fetal Bovine Serum (FBS) ...
-
bioRxiv - Developmental Biology 2021Quote: ... HESCs were transfected with a total of 4ug DNA in a ratio 2:3 (gRNAs:donor template) using the Amaxa P3 Primary Cell 4D-Nucleofector Kit (Lonza). Puromycin was added 3 days after electroporation at a concentration of 0.5ug/ml ...
-
bioRxiv - Cell Biology 2022Quote: Human umbilical vein endothelial cells (HUVEC) were cultured between passage 3 and 6 in EGM-2 complete medium (Lonza)3,52–55 ...
-
bioRxiv - Bioengineering 2024Quote: ... and SK-BR-3 cells (Korean Cell Line Bank, Korea) were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Lonza, Switzerland) supplemented with 10 % (v/v ...
-
bioRxiv - Cancer Biology 2024Quote: ... and (iv) the NDF-2 and NDF-3 cell lines (human neonatal dermal fibroblast cell lines, #CC-2509; Lonza Bioscience ...
-
bioRxiv - Cancer Biology 2023Quote: ... Regular testing for mycoplasma contamination was conducted every 3-4 weeks using the MycoAlert PLUS mycoplasma detection kit (Lonza).
-
bioRxiv - Cell Biology 2022Quote: Normal human bronchial epithelial cells (HBECs) from 3 independent donors (Supplemental Table S1) were obtained from Lonza (CC-2540) and cultured in BEGM growth media (Lonza CC-3170) ...
-
bioRxiv - Biophysics 2023Quote: ... DNA samples were also analyzed by electrophoresis through 1.5 % and 3 % agarose gels (Seakem LE agarose, Lonza, Rockland, ME) in TAE (Tris-acetate + 1 mM EDTA ...
-
Self-organised pattern formation in the developing neural tube by a temporal relay of BMP signallingbioRxiv - Developmental Biology 2023Quote: A total of 3-4µg of plasmid DNA was electroporated into 3-4x106 early passage ES cells using the Amaxa Nucleofector II (Lonza) programme A-023 ...
-
bioRxiv - Neuroscience 2024Quote: ... and 300μM single stranded oligodeoxynucleotides (ssODN: 5’gggtccagggtggctgtcactcat ccttttttctggctaccaaaggtgcagataattaaGaagaagctggatcttagcaacgtccagccaagtgtggctcaaaggataatatc aaacacgtcc 3’) and the P3 Primary Cell 4D reaction mix (Lonza). We screened a minimum of 96 clones for genetic editing ...
-
bioRxiv - Genetics 2024Quote: ... Approximately 2.5×105 CD34+ HSPCs were mixed with gRNA:Cas9 complexes and 3 µg ssDNA donor template (20 μL) in nucleofector strip format (Lonza). Electroporation was performed in Unit X ...
-
bioRxiv - Cell Biology 2024Quote: ... NHEKs (no later than passage 3) were cultured in KGM Gold Keratinocyte Growth Medium BulletKit (00192060, Lonza, Basel, Switzerland). For daily maintenance and subculturing of NHEKs ...
-
bioRxiv - Cell Biology 2020Quote: ... Primary XP-C patient fibroblasts XP168LV were cultured at 37°C in an atmosphere of 5% CO2 in Ham’s F10 medium without thymidine (Lonza) supplemented with 20% fetal calf serum and antibiotics.
-
bioRxiv - Genetics 2021Quote: ... Two million WTC iPSC were nucleofected using an Amaxa nucleofector 2B and the Nucleofector Kit C (both from Lonza), 0.5 µg of each AAVS1 TALEN pair and 1 µg of the donor plasmid (see Figure S4) ...
-
bioRxiv - Biochemistry 2022Quote: ... S2 cells were selected at 27°C in complete Schneider’s medium and then transferred to Insect Xpress medium (Lonza) for large-scale expression in 2-liter Erlenmeyer flasks ...
-
bioRxiv - Molecular Biology 2021Quote: ... were grown at 37°C (5 % CO2) in supplemented DMEM: Dulbecco’s Modified Eagle’s Medium with 4.5 % glucose (Lonza, Visp, Switzerland) supplemented with 10 % fetal bovine serum (Gibco ...