Labshake search
Citations for Lonza :
151 - 200 of 1623 citations for Rat Neurotrimin NTM ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... MCF-10A [MEBM supplemented with Kit CC-3150 (Lonza) and 100 ng/mL cholera toxin (Sigma)] ...
-
bioRxiv - Cell Biology 2023Quote: — MycoAlert Mycoplasma Detection Kit (Lonza cat. no. LT07-118)
-
bioRxiv - Cancer Biology 2023Quote: ... with an SF kit (Catalog: V4CX-2032, Lonza Biosciences) as per manufacturer instructions using pulse code CM-120 ...
-
bioRxiv - Cell Biology 2023Quote: ... using the MycoAlert™ Detection Kit (Lonza, #LT07-418) and MycoAlert™ Control Set (Lonza ...
-
bioRxiv - Cancer Biology 2023Quote: ... All cell lines were mycoplasma negative (MycoAlert kit, Lonza). Experiments were performed using charcoal-stripped serum (CTS) ...
-
bioRxiv - Cell Biology 2023Quote: ... in combination with Nucleofector Kit V (Lonza, VCA-1003) according to the manufacturer’s recommended protocol.
-
bioRxiv - Molecular Biology 2023Quote: ... checked monthly using the MycoAlert Mycoplasma Detection Kit (Lonza). Tumour-derived cell lines were confirmed to match original samples by STR fingerprinting ...
-
bioRxiv - Cancer Biology 2023Quote: ... and supplemented with Fibroblast Growth Kit Serum-Free (Lonza) to improve growth and viability in dialyzed FBS ...
-
bioRxiv - Cell Biology 2024Quote: ... with the P3 Nucleofector kit (Lonza, Cat. # V4SP-3096). Naïve murine CD8+ T cells (2 x 106 ...
-
bioRxiv - Molecular Biology 2024Quote: ... using the MycoAlert Mycoplasma Detection Kit (Lonza LT07-318).
-
bioRxiv - Cancer Biology 2024Quote: ... Cell Line NucleofectorTM Kit V (Catalog #: VCA-1003) (Lonza) was used for transfection procedure according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... with an Amaxa Mouse Dendritic Cell Nucleofection Kit (Lonza). The abovementioned pIRES2-AcGFP1-series plasmids were used for transient expression ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cell lines were periodically tested for mycoplasma using the EZ-PCR™ Mycoplasma Detection Kit (Biological Industries, Cromwell, CT, USA) and the MycoAlert™ Mycoplasma Detection Kit (Lonza, Basal, Switzerland) and were confirmed to be mycoplasma free ...
-
bioRxiv - Cancer Biology 2021Quote: ... using buffer R (Amaxa Nucleofector Kit R VCA-1003; Lonza) and program R-001 ...
-
bioRxiv - Cell Biology 2020Quote: ... siRNA delivery was performed using either Nucleofector Kit V (Lonza) or Neon transfection system (Life Technologies ...
-
bioRxiv - Immunology 2021Quote: ... contamination with the MycoAlert Mycoplasma Detection kit (Lonza LT-07). Cell lines were not authenticated.
-
bioRxiv - Neuroscience 2020Quote: The adenylate kinase assay (ToxiLightTM bioassay kit LT07-217 Lonza) to assess toxicity was performed following the instructions of the manufacturer ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4 days after nucleofection with the AMAXA Nucleofector Kit (Lonza), we applied puromycin selection until we observed the appearance of green colonies ...
-
bioRxiv - Cell Biology 2019Quote: ... MCF 10A cells were cultured in the MEGM kit (Lonza) at 37°C with 5% CO2 ...
-
bioRxiv - Bioengineering 2020Quote: ... with a 20 μl P3 solution kit (Lonza, #V4XP-3032) with 600k PGP1 WT cells in each 20 μl reaction well as per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... Mycoplasma contamination was tested using MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Immunology 2021Quote: ... Cells were transfected using the Amaxa HUVEC Nucleofector kit (Lonza) according to the manufacturer’s protocol (2-5 µg plasmid DNA ...
-
bioRxiv - Bioengineering 2020Quote: ... supplemented with EGM Endothelial Cell Growth Medium SingleQuots Kit (Lonza) and used at passage 3-6 ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were suspended in EGM Media with Bullet Kit (Lonza) supplemented with 1μM Chiron ...
-
bioRxiv - Neuroscience 2021Quote: ... using an Amaxa Mouse Neuron Nucleofector kit (Lonza, VPG-1001) as described previously (Wuttke et al. ...
-
bioRxiv - Cancer Biology 2021Quote: ... supplemented with recommended growth supplement kit (EGM-2MV BulletKit, Lonza). Mouse mammary carcinoma cell line 4T1-luc-red (generously given by the Cross laboratory at University of Virginia ...
-
bioRxiv - Cell Biology 2021Quote: ... using the Amaxa human keratinocyte Nucleofector kit (Lonza, #VPD-1002) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... fibroblasts were transfected by nucleofection (Kit V4XP-2024, Lonza, Switzerland) with the gene drive plasmid ...
-
bioRxiv - Microbiology 2019Quote: ... and using the Amaxa human CD34+ cells Nucleofection Kit (Lonza), following the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2021Quote: ... from the P3 Primary Cell 96-well Nuclofector kit (Lonza). 3 µL of the assembled Cas9 RNPs were added to the cells ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mycoplasma testing using the MycoAlert detection kit (Lonza, Ben OR) was performed every 2 months ...
-
bioRxiv - Immunology 2022Quote: ... Cells were nucleofected using Cell Line Nucleofector Kit V (Lonza) for cell lines and P3 Primary Cell 4D-Nucleofector X Kit L (Lonza ...
-
bioRxiv - Bioengineering 2022Quote: ... were cultured in a supplemented (EGM-2 bullet kit, LONZA) endothelial cell growth medium (Lifeline Cell Technology ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mycoplasma infection monitoring was performed using MycoAlert Detection Kit (Lonza) and only mycoplasma-free cultures were used.
-
bioRxiv - Cancer Biology 2021Quote: ... based on routine testing with MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Bioengineering 2021Quote: ... tested for mycoplasma contamination using the MycoAlert Microplasma Kit (Lonza), and cultured with 0.2-micron filtered DMEM media (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mycoplasma screening was performed using a MycoAlert detection kit (Lonza). Cell lines were maintained at 37°C and 5% CO2 ...
-
bioRxiv - Developmental Biology 2019Quote: ... cells were kept in HCM medium (HCM Bullet Kit, Lonza) supplemented with “singlequots” supplied with the kit (except for the EGF ...
-
bioRxiv - Cancer Biology 2020Quote: ... as screened with the MycoAlert® Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... using the MycoAlert PLUS assay kit from Lonza (Basel, Switzerland), and were authenticated by short tandem repeat profiling.
-
bioRxiv - Neuroscience 2021Quote: ... 4D-Nucleofector™ unit X Kit (program CA-137; Lonza) was used according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... Cultures were tested for mycoplasma using a MycoAlert Kit (Lonza), and for bacteria ...
-
bioRxiv - Bioengineering 2022Quote: ... 5% CO2 in EGM-2 Bullet Kit (Lonza CC-3162) medium and used between passages 4-8.
-
bioRxiv - Cell Biology 2023Quote: ... Nucleofection was performed using the Amaxa MEF2 Nucleofector Kit (Lonza) following the manufacturer’s suggested protocol ...
-
Chromatin priming elements direct tissue-specific gene activity prior to hematopoietic specificationbioRxiv - Genomics 2023Quote: ... with the P3 Primary Cell X kit (Lonza, V4XP-3024). ES cells clones were picked and screened for successful homologus CRISPR by PCR using primers designed outside of the CRISPR guide region (AAGGCTGTCTAGCACTCGTT ...
-
bioRxiv - Neuroscience 2023Quote: ... using the P3 Primary Cell nucleofector kit (Lonza, V4XP-3012). 8×105 cells were resuspended in 100µl P3 solution ...
-
bioRxiv - Systems Biology 2023Quote: ... and Mouse Embryonic Stem Cell NucleofectorTM Kit (#VPH-1001, Lonza). Three biological replicates were performed per library on different days ...
-
bioRxiv - Biochemistry 2023Quote: ... Using Amaxa SF Cell Line 4D-Nucleofector X Kit (Lonza), WT HEK293T cells were transfected with a transposase-encoding plasmid (pSB100X) ...
-
bioRxiv - Biochemistry 2022Quote: ... Cultures were tested regularly with MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Bioengineering 2023Quote: ... SE and P3 Cell Line 4D-Nucleofector X Kit (Lonza) was used as the nucleofection agent following the manufacturer’s protocol ...