Labshake search
Citations for Lonza :
151 - 200 of 342 citations for 5 Alpha dihydroprogesterone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... kept with males and fed with yeast paste (n=5) were dissected in Schneider’s media (Lonza; LZ04-351Q) containing 200 μg/mL insulin (Sigma ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Isolated NK cells were activated at 1 x 106 cells mL-1 for 5 days in XVivo15 medium (Lonza) with 5% fetal bovine serum ...
-
bioRxiv - Cell Biology 2020Quote: ... Primary XP-C patient fibroblasts XP168LV were cultured at 37°C in an atmosphere of 5% CO2 in Ham’s F10 medium without thymidine (Lonza) supplemented with 20% fetal calf serum and antibiotics.
-
bioRxiv - Cell Biology 2020Quote: ... mouse skeletal myoblasts were grown at 37°C with a 5% CO2 humidified atmosphere in Dulbecco’s Modified Eagle’s Medium with 4.5 g.L−1 Glucose (DMEM; Lonza Bioscience, Bâle, Zwitzerland), supplemented with 10% fetal Bovin Serum (FBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... were grown at 37°C (5 % CO2) in supplemented DMEM: Dulbecco’s Modified Eagle’s Medium with 4.5 % glucose (Lonza, Visp, Switzerland) supplemented with 10 % fetal bovine serum (Gibco ...
-
bioRxiv - Genomics 2020Quote: ... and 5×104 cells were resuspended in 20 μL SF electroporation buffer prepared with SF supplement (Lonza, Basel, Switzerland). 3 μL RNP complex solution was mixed with the cells and the cells were nucleofected using program DJ-110 on a 4D-Nucleofector (Lonza ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 × 106 of EGFP-PGCs were resuspended in a total volume of 100 μl Nucleofector Solution V (Lonza, Switzerland) premixed with 10 μg of Cas9 plasmid and the same amount of phiC31 integrase ...
-
bioRxiv - Genetics 2020Quote: ... 5μg vector (in 5μl) transfected into 5 million CD4 T cells in 100μl 1M nucleofection solution67) using a Nucleofector 2b device (Lonza; program V024 for resting T cells and T023 for stimulated T cells) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5×106 EL16.7 TST ESCs were nucleofected with the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-1001) using program A-30 with 1.6 µg each of GFP and tdTomato circularised targeting vectors and 5 µg single gRNA vector PX459 (5’-TATACCTAATCATTATGCCG-3’ ...
-
bioRxiv - Cell Biology 2021Quote: Whole-mount Drosophila ovary samples (approximately 5 flies per experiment) were dissected into Grace’s insect media (Lonza, Walkersville, MD) and fixed for 10 minutes at room temperature in 4% paraformaldehyde in Grace’s insect media ...
-
bioRxiv - Bioengineering 2021Quote: ... were used between passages 3-5 for paxillin experiments and culture medium was changed every 2-3 days (Lonza FBM Basal Medium supplemented with 2 v/v% fetal bovine serum (FBS) ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA directed against Dsg1 (Integrated DNA Technologies) with a targeting sequence 5′-CCATTAGAGAGTGGCAATAGGATGA-3′ using Amaxa Nucleofector System (Lonza) for electroporation of cells according to manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2022Quote: ... 5 μg of DNA was used to transfect the cells using the Amaxa Cell Line Nucleofector kit (Lonza Bioscience) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Cell pellets were carefully enrobed in an equal volume of molten 5% low-melting temperature agarose (Lonza, Rockland, ME) and allowed to cool ...
-
bioRxiv - Microbiology 2021Quote: ... was adjusted to OD600 of 2.5 (2.2 × 109 bacteria/mL) and the bacteria were then further diluted in serum-free XVIVO-15 medium (Lonza) prior to infection to obtain the respective multiplicity of infection (MOI) ...
-
bioRxiv - Immunology 2021Quote: ... Naive CD4+ T cells were cultured at 5% CO2/37°C in serum-free X-Vivo 15 medium (Lonza).
-
bioRxiv - Microbiology 2021Quote: ... HXGPRT amplicon (2-5 µg) into 1x106 RH TIR1-3FLAG tachyzoites in P3 buffer using a 4D-nucleofector (Lonza) with pulse code FI-158 ...
-
bioRxiv - Microbiology 2021Quote: ... Cell pellets were carefully enrobed in an equal volume of molten 5% low-melting temperature agarose (Lonza, Rockland, ME) and allowed to cool ...
-
bioRxiv - Immunology 2022Quote: ... were coated overnight at 4°C with 25μL of SEC fractions 1 to 5 diluted 1:2 with PBS (Cat. No. LZBE17-512F, Lonza). Wells were washed with 0.05% Tween-20 (Cat ...
-
bioRxiv - Microbiology 2022Quote: ... and the well was gently washed once with 5 mL of phosphate buffered saline (PBS, Lonza, Rockland, ME, USA) to remove un-adherent floating bacteria ...
-
bioRxiv - Microbiology 2022Quote: ... Cell pellets were carefully enrobed in an equal volume of molten 5% low-melting temperature agarose (Lonza, Rockland, ME) and allowed to cool ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were harvested with trypsin, pelleted (500 g, 5 min, 4°C) and resuspended in PBS (pH 7.4) containing EDTA (Lonza) and 10% fetal bovine serum ...
-
bioRxiv - Cancer Biology 2024Quote: ... Red blood cell lysis was performed for 5 min at room temperature in ACK lysing buffer (Lonza, #10-548E). For flow cytometry ...
-
bioRxiv - Microbiology 2024Quote: ... Cell pellets were carefully enrobed in an equal volume of molten 5% low-melting temperature agarose (Lonza, Rockland, ME) and allowed to cool ...
-
bioRxiv - Biochemistry 2023Quote: Plasma cholesterol was depleted by treating HEK293 cells with 5 mM MβCD for 30 min in Pro293A-CDM (Lonza); this short period of MβCD treatment was deemed sufficient to removed 50% of endogenous cholesterol from cells (34) ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were harvested with trypsin, pelleted (500 g, 5 min, 4°C) and resuspended in PBS (pH 7.4) containing EDTA (Lonza) and 10% fetal bovine serum ...
-
bioRxiv - Biochemistry 2024Quote: Human HeLa cells (ATCC) were grown at 37°C in 5% CO2 using Dulbecco’s Modified Eagle Medium (Lonza, USA) supplemented with 10% FBS superior (Biochrom ...
-
bioRxiv - Cell Biology 2023Quote: ... RNP were formed by mixing 5 to 9 μgr base editor protein with 1.5 μgr of sgRNA in 20 μL of P3 buffer (Lonza, Amaxa P3 Primary Cell 4D-Nucleofector Kit ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were pelleted at 1000 rpm for 5 min and resuspended in 100 μL nucleofector solution (Lonza, #VPB-1002) before adding 2.5 μg of plasmid ...
-
bioRxiv - Developmental Biology 2023Quote: ... were cultured at 37°C and 5% CO2 in EGMTM Endothelial Cell Growth Medium with BulletKitTM (Lonza CC-3124) and 1x antibiotic-antimycotic (Gibco ...
-
bioRxiv - Immunology 2023Quote: ... Cas9-gRNA ribonucleoproteins were assembled as described previously53 and nucleofected into 5×106 monocytes in 100μL nucleofection buffer (Human Monocyte Nucleofection Kit, Lonza) using a Nucleofector 2b (Lonza ...
-
bioRxiv - Genomics 2023Quote: ... Cells were grown at 37°C and 5% CO2 and passed with Hepes buffered saline solution (Lonza, CC-5024) and 0.25% Trypsin-EDTA (Gibco ...
-
bioRxiv - Bioengineering 2023Quote: Primary human alveolar epithelial cells (HPAECs, CellBiologics) were cultured at 37°C and 5% CO2 with SABM medium (Lonza), SAGM supplements (Lonza) ...
-
bioRxiv - Neuroscience 2024Quote: ... and 300μM single stranded oligodeoxynucleotides (ssODN: 5’gggtccagggtggctgtcactcat ccttttttctggctaccaaaggtgcagataattaaGaagaagctggatcttagcaacgtccagccaagtgtggctcaaaggataatatc aaacacgtcc 3’) and the P3 Primary Cell 4D reaction mix (Lonza). We screened a minimum of 96 clones for genetic editing ...
-
bioRxiv - Biochemistry 2024Quote: Human lung carcinoma A549 cells (ATCC) were grown at 37°C in 5% CO2 using Dulbecco’s Modified Eagle Medium (Lonza) supplemented with 10% FBS superior (Biochrom ...
-
bioRxiv - Cell Biology 2024Quote: Primary human mammary epithelial cells (HMECs) were cultured at 37°C with 5% CO2 in MEBM basal medium (Lonza) supplemented with MEGM SingleQuots (Lonza ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were maintained at 37°C and 5 % CO2 in a humidified atmosphere and routinely tested to be mycoplasma negative (MycoAlert Mycoplasma Detection Kit, Lonza). Cells were cultured no longer than 15 passages before experimental use.
-
bioRxiv - Neuroscience 2021Quote: ... Cells were resuspended and transfected by combining 5×105 viable cells with 400 ng plasmid DNA and nucleofection solution in a 25 µL electroporation cuvette (Lonza). Electroporation of GCaMP mutants was performed according to the manufacturer’s protocol.
-
bioRxiv - Microbiology 2020Quote: ... 3 x 107 bloodstream form cells were harvested by centrifugation and transfected with 5-10 μg of linearized plasmid DNA using an Amaxa Nucleofector II (Lonza) with program X-001 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were transfected by combining 5×105 viable cells with 400 ng plasmid DNA and nucleofection solution electroporation cuvettes (Lonza). Electroporation was performed according to the manufacturer instructions ...
-
bioRxiv - Genetics 2020Quote: ... ∼1×106 cells were transfected with pairs of 5 µg gRNA plasmid and 4 µg ssODN (Supplementary Table 3) using AmaxaTM Human CD34 Cell NucleofectorTM Kit (Lonza) in the 2B-NucleofectorTM on the U-08 setting ...
-
bioRxiv - Immunology 2021Quote: ... of four genetically independent donors were grown as monolayers in 100% humidity and 5% CO2 at 37 °C in serum-free defined growth media (BEGM, Lonza). NHBEs (passage 3 ...
-
bioRxiv - Genomics 2020Quote: ... 5 million cells were transfected with 5 μg of DNA FAIRE-STARR library plasmid using the Amaxa Nucleofector kit V (Lonza). For each condition ...
-
bioRxiv - Bioengineering 2020Quote: ... were cultured under standard incubation conditions at 37 °C and 5% CO2 in endothelial growth media (EGM BulletKit CC-3124, Lonza). For all imaging experiments ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were maintained in culture at 37°C with 5% CO2 and regularly screened to ensure the absence of mycoplasma contamination (MycoAlert, Lonza).
-
bioRxiv - Cancer Biology 2020Quote: ... All cell lines were maintained in 37 °C and 5% CO2 incubators and routinely tested negative for mycoplasma contamination using the MycoAlert Kit (Lonza).
-
bioRxiv - Cancer Biology 2020Quote: ... The cells were grown in a humidified incubator at 37°C with 5% CO2 and routinely tested for mycoplasma infection (MycoAlert, Lonza). The identity of the cell line was confirmed by DNA fingerprinting (Laragen ...
-
bioRxiv - Cancer Biology 2020Quote: ... were cultured according to manufactureŕs instructions in a humidified incubator with 5% CO2 at 37 °C and routinely checked and tested negative for mycoplasma contamination using MycoAlertPlusTM Mycoplasma Detection Kit (Lonza) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... The RNP complex and 1.5 μg of a linearized homology-directed repair template plasmid were transfected into 2×105 – 5×105 nocodazole-arrested mitotic HeLa A12 cells using a Nucleofector and the associated Cell Line Kit R (Lonza) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... was combined with 15 pmol total synthetic sgRNA (5 pmol each sgRNA) (Synthego) to form ribonucleoproteins (RNPs) in 20uL total volume with SE Buffer (Lonza). The RNP assembly reaction was mixed by pipetting up and down and incubated at room temperature for 10 minutes.