Labshake search
Citations for Lonza :
151 - 200 of 2172 citations for 2 1 ethylpentyl 1 3 dioxan 5 yl laurate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: ... USA) were cultured in 5% fetal bovine serum containing endothelial cell growth medium (EGM-2; Lonza, Basel, Switzerland). Media was supplemented with heparin ...
-
bioRxiv - Bioengineering 2022Quote: ... GM-3TM Lymphocyte Growth Medium-3 (LGM-3™) (Lonza), Opti-MEM Serum-Free medium (Thermofisher) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5 µg of PX459 gRNA vector (5’-GACTCCAGTCTTTCTAGAAGA-3’) were nucleofected with the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-100) using program A-30 in the XRep ...
-
bioRxiv - Cell Biology 2022Quote: hTERT immortalized RPE-1 (RPE1) cell lines were grown in an 1:1 mix of DMEM and F-10 (Lonza) and Human Embryonic Kidney (HEK ...
-
bioRxiv - Synthetic Biology 2022Quote: 1 x 106 BHK-21 cells were electroporated with a total of 7.8 μg of mRNA (1:1:1 of pSinHelper, pSinCapsid and pTSin-EGFP/pTSin-SRF-NLS-VP64) using Amaxa 2B (Lonza) as per the manufacturer’s instructions for BHK-21 cells ...
-
bioRxiv - Microbiology 2020Quote: ... 100 IU ml-1 penicillin-100 µg ml-1 streptomycin mixture (Lonza), 2 mM L-glutamine (Lonza) ...
-
bioRxiv - Microbiology 2020Quote: ... 100 IU ml-1 penicillin-100 µg ml-1 streptomycin mixture (Lonza), 200 mM L-glutamine (Lonza) ...
-
bioRxiv - Genomics 2020Quote: ... 1% Na-pyruvate (Lonza), 1% antibiotic-antimycotic solution (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... 1% penicillin streptomycin (Lonza), 100 μM L-ascorbic acid (Sigma) ...
-
bioRxiv - Cell Biology 2021Quote: ... 1% streptomycin/penicillin (Lonza), at 37° C with 5% CO2 and humidified atmosphere ...
-
bioRxiv - Cell Biology 2020Quote: ... 1% penicillin/streptomycin (Lonza), 20 ng/mL EGF (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: ... all cells were centrifuged at 220 xg RT for 5 min followed by resuspension with fresh complete media and plated at 1:5 (Cell Systems cells)-1:10 (Lonza cells) dilutions ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1% Glutamine (Lonza), and seeded on Xona silicon device (#RD450 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1% penicillin/streptomycin (Lonza), and 1% L-glutamine (Lonza) ...
-
bioRxiv - Genomics 2020Quote: ... 1% Na-pyruvate (Lonza), 1% non-essential amino acid solution (Lonza) ...
-
bioRxiv - Immunology 2020Quote: ... 1% P/S (Lonza), and 1 mM L-Gln (Lonza ...
-
bioRxiv - Immunology 2020Quote: ... 1% Pen/Strep (Lonza), 1% GlutaMAX™(Gibco) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1% L-Glutamine (Lonza), 0,4% sodium-pyruvate (Sigma ...
-
bioRxiv - Microbiology 2024Quote: ... 1% sodium bicarbonate (Lonza) and 2mM L-glutamine (Lonza) ...
-
bioRxiv - Biochemistry 2023Quote: ... 1% sodium pyruvate (Lonza), 1% 1xnonessential amino acids (Lonza) ...
-
bioRxiv - Biochemistry 2023Quote: ... and 1% HEPES (Lonza)) ...
-
bioRxiv - Biophysics 2022Quote: ... 1% penicillin–streptomycin (Lonza) and 2 mM L-glutamine (Lonza) ...
-
bioRxiv - Genomics 2022Quote: ... 1% penicillin-streptomycin (Lonza), 0.1 mM β-mercaptoethanol and 4 ng/ml FGF2 ...
-
bioRxiv - Immunology 2022Quote: ... 1% p/s (Lonza) (sort medium ...
-
bioRxiv - Immunology 2022Quote: ... 1% penicillin-streptomycin (Lonza) and 1% Ultra-glutamine (Lonza) ...
-
bioRxiv - Pathology 2022Quote: ... 1% L-glutamine (Lonza), and 0.1 mM 2-mercaptoethanol (Thermo-Fisher) ...
-
bioRxiv - Immunology 2024Quote: ... 1% L-glutamine (Lonza), and from the second passage ...
-
bioRxiv - Immunology 2024Quote: ... 1% Penicillin/Streptomycin (Lonza). THP-1 cells (Cat#TIB-202 ...
-
bioRxiv - Immunology 2024Quote: ... 1% L-glutamine (Lonza), 1% Penicillin/Streptomycin (Lonza) ...
-
bioRxiv - Microbiology 2021Quote: ... HXGPRT amplicon (2-5 µg) into 1x106 RH TIR1-3FLAG tachyzoites in P3 buffer using a 4D-nucleofector (Lonza) with pulse code FI-158 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Molecular Biology 2021Quote: ... UW289.B1 was grown in 1:1 mixture of RPMI and MGEM (Lonza) with Single Quots (Lonza ...
-
bioRxiv - Biochemistry 2020Quote: ... 100 U ml−1 penicillin and 100 μg ml−1 streptoMycin sulfate (Lonza). Cells were split and/or harvested at 80-90% confluency using 0.05% Trypsin–EDTA.
-
bioRxiv - Cell Biology 2024Quote: ... at a ratio of 1:1 in media composed of X-VIVO15 (Lonza) + 10% huABS (Valley Biomedical ...
-
bioRxiv - Immunology 2022Quote: ... at 1:1 ratio in T cell media: RPMI 1640 (Lonza #BE12-702F), 10% heat-inactivated fetal bovine serum (Gibco #10-082-147) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... were mixed at a 5:1 molar ratio and nucleofected using the CB-150 program and P3 primary reagents (Lonza, Cat. No. V4XP-3032) on a Lonza 4D nucleofector following manufacturer protocol ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were regularly passaged 2-3 times a week and routinely tested for mycoplasma contamination using MycoAlert Plus mycoplasma Detection kit (Lonza, #LT07-710).
-
bioRxiv - Cell Biology 2020Quote: ... Conditioned media (containing EVs) was removed and the cells washed x 2 with PBS before trypsinisation using 1 × Trypsin-EDTA (Lonza, UK cat: T3924). Cell counts and viability were checked at the time of EV harvest using the trypan blue exclusion assay (0.4% Trypan blue solution ...
-
bioRxiv - Developmental Biology 2022Quote: Primary HDLECs were isolated from neonatal human foreskins as described previously (74) and cultured from passages 5 – 7 on fibronectin-coated plates with EGM-2 MV growth media (Lonza) supplemented with human VEGF-C (R&D) ...
-
bioRxiv - Immunology 2021Quote: Human telomerase-immortalized corneal epithelial (hTCEpi) cells (26) were maintained at 37°C/5% CO2 in regular keratinocyte growth medium KGM-2 (Lonza). Prior to treatment ...
-
bioRxiv - Immunology 2021Quote: ... CD3/CD28 beads were removed 48 hours after stimulation and 5 × 106 CTLs were electroporated with 2 μg plasmid using 4D-Nucleofector (Lonza). Medium was changed 6 hours after nucleofection and transfected cells were used 24-36 hours after electroporation ...
-
bioRxiv - Developmental Biology 2022Quote: ... Primary MEC were cultured in endothelial growth media (EGM) containing 5% FBS with growth factors (EBM-2; Lonza, Basel, Switzerland) at 37°C in 5% CO2 ...
-
bioRxiv - Cell Biology 2024Quote: ... cells (5×105/well in 6-well plates) were transfected with 2 μg of DNA by nucleofection using Amaxa device (Lonza) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were seeded on the fibronectin-coated Petri dish (TPP) and kept in the incubator (37 °C and 5% CO2) for 4-8 h in the EGM-2 (Lonza) containing 2% FBS ...
-
bioRxiv - Neuroscience 2020Quote: ... at a 1:50 ratio and run in a 1% agarose gel (Lonza, Switzerland) at 100 V for 30 min and stained with SYBR safe dye (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... supplemented with 100 IU ml-1 penicillin-100 µg ml-1 streptomycin mixture (Lonza), 2 mM L-glutamine (Lonza) ...
-
bioRxiv - Cell Biology 2020Quote: ... and 1× MycoZap antibiotics (Lonza) at 37°C (5% CO2 and 95% humidity) ...
-
bioRxiv - Cell Biology 2020Quote: ... and 1% penicillin-streptomycin (Lonza). All the human and mouse normal primary cells were maintained in 5% O2 ...
-
bioRxiv - Neuroscience 2021Quote: ... 1% Penicillin-Streptomycin (Lonza, Switzerland) and 0.5 mM L-glutamine ...