Labshake search
Citations for Lonza :
151 - 200 of 1904 citations for 1 Piperidineacetamide 4 2 benzothiazolyl N 4 4 morpholinyl phenyl 9ci since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... and 20 μg of the donor DNA using the Amaxa 4-D Nucleofactor X machine (Pulse code FP158) and P3 Primary Cell Kit (Lonza), according to protocols described by Moon et al ...
-
bioRxiv - Neuroscience 2024Quote: ... Four wells of EBs per line were seeded in a 4-layer cell discs coated with growth factor-reduced matrigel in X-VIVO15 medium (Lonza) supplied with GlutaMAX (Gibco) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the paired RNPs were combined and nucleofected into 4×105 Raw 264-7 cells suspended in 10 ul of nucleofection buffer (Lonza) using the program DS-136 in a 4D Nucleofector X Unit (Lonza) ...
-
bioRxiv - Neuroscience 2024Quote: ... 500 pmol Cas12 crRNA (GGAAAAGTAAAAGATGTCTGAAT, IDT) and 20 μg recombinant Cas12 (IDT) using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) and 4D-Nucleofector X unit (Lonza ...
-
bioRxiv - Systems Biology 2024Quote: ... 20 µL of cell suspension was then gently mixed with each crRNP and aliquoted into a 96-well electroporation cuvette for nucleofection with the 4-D Nucleofector X-Unit (Lonza) using pulse code EO-120 ...
-
bioRxiv - Immunology 2024Quote: ... A volume of 20 μL of cells was then transferred to the Nucleocuvette stripwell and electroporated with program DN-100 on a 4-D Nucleofector X unit (Lonza). Immediately after nucleofection ...
-
Synchronous 3D patterning of diverse CNS progenitors generates motor neurons of broad axial identitybioRxiv - Neuroscience 2024Quote: ... For the generation the ISL1 reporter line cells were nucleofected with pTG-Cr-ISL1 and pTG-HR-ISL1-p2A-mNeonGreen plasmids using a 4-D nucleofector system (AMAXA) and the P3 Primary Cell 4D-Nucleofector Kit (Lonza) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Human primary hepatic stellate cells from donors 3 and 4 were purchased as isolated hepatic stellate cells from Lonza (cat# HUCLS). Donor information is listed below.
-
bioRxiv - Immunology 2021Quote: ... Buffy coat cells were washed three times in 2.5 mM EDTA-PBS at 4°C before dilution and maintenance in RPMI-1640 supplemented with 10% FCS (PAA, AT or Lonza, CH) 2 mM glutamine ...
-
bioRxiv - Genomics 2021Quote: The MPRA libraries were electroporated in 4 to 6 million cells each using the Nucleofector 2b or 4D (Lonza, Basel, Switzerland) with 6 µg of plasmid DNA and program T-030 or Y-001 and DS-132 ...
-
bioRxiv - Physiology 2022Quote: ... 5 million cells were washed with phosphate buffered saline (PBS) and electroporated with 4-6 μg of appropriate plasmid construct using an Amaxa cell nucleofector (Lonza laboratories) and nucleofection reagent (362.88 mM ATP-disodium salt ...
-
bioRxiv - Neuroscience 2023Quote: ... Nucleofection was performed using the 4-D nucleofector system (AMAXA) and the P3 Primary Cell 4D-Nucleofector Kit (Lonza, V4XP-3024) following manufactures’ instructions (program CB-150) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were grown under sterile conditions for no longer than 4 weeks after thawing and were frequently tested for Mycoplasma using the MycoAlert® Assay kit (Lonza).
-
bioRxiv - Cell Biology 2024Quote: ... DCs derived from progenitor cells were transfected with 4 μg of DNA using the nucleofector kit for primary T cells (Amaxa, Lonza Group) following the manufacturer’s guidelines ...
-
bioRxiv - Cell Biology 2021Quote: ... and cells were isolated by centrifugation at 500 g for 5 min at 4°C followed by being treated with ACK Lysing Buffer (10-548E, Lonza Bioscience, Switzerland) to remove red blood cells ...
-
bioRxiv - Immunology 2020Quote: ... 106 cells per condition were nucleofected with 4 µg of DNA using the Amaxa Nucleofector II (Lonza, Kit R; program R-024). Nucleofected cells were allowed to recover for 24-48 hours before sorting for GFP positivity and lack of CD56 expression.
-
bioRxiv - Immunology 2020Quote: ... Transfection of primary T cells with Cas9 RNP complexes and TCRβα HDR templates was performed 3-4 days following activation using the 4D-Nucleofector and a 20 uL format P3 Primary Cell kit (Lonza, V4XP-3032). Briefly ...
-
bioRxiv - Bioengineering 2024Quote: ... RNP’s and DNA were electroporated (EP) into T-cells in 16 well EP cuvettes on a 4-D Nucleofector X unit (Cat # V4XP-3032, Lonza, Walkersville, VA) using pulse code EH-115 ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were electroporated at 5 million cells/100 mL cells per cuvette using a Lonza 4-D nucleofector with pulsecode DP-148 (Lonza, VVPA-1002). Cells were co-cultured for 5 additional days with human astrocyte before transferring cells to homeostatic culture conditions (MGdM media ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... droplets in 6 well plates and treated with retinoic acid for 4 days followed by hepatocyte growth media (Hepatocyte Culture Medium BulletKit (Lonza, CC-3198) supplemented with 10 ng/mL hepatocyte growth factor (PeproTech ...
-
bioRxiv - Cell Biology 2024Quote: All eight guide plasmids (4 for Sun1 and 4 for Sun2) were transfected into A549 cells using the Amaxa Cell Line Nucleofector Kit T (Lonza Bioscience, VCA-1002) according to the manufacturer’s instructions and plated into a 10cm plate in A549 media ...
-
bioRxiv - Biophysics 2021Quote: ... and 1% Penicillin/Streptomycin (Lonza, Cat N. DE17-602E), and maintained in cell culture flask (Corning ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mM Ultraglutamine 1 (Lonza) and 1× MycoZap antibiotics (Lonza ...
-
bioRxiv - Cancer Biology 2023Quote: SK-N-BE (2) (ATCC: no. CRL-2271) cells were cultured in Dulbecco’s Modified Eagle Medium (Lonza, Cat# BW12614F), supplemented with heat-inactivated FBS (Hyclone ...
-
bioRxiv - Microbiology 2021Quote: ... while HO-1-N-1 (JCRB0831) cells were cultured in DMEM/F-12 (Dulbecco’s Modified Eagle Medium:F12; Lonza) medium ...
-
bioRxiv - Immunology 2020Quote: ... diluted 1:100 in EBM-2 (Lonza). Cells were used for experiments within 3-5 passages ...
-
bioRxiv - Microbiology 2023Quote: ... with a final concentration of 2% formaldehyde and 2% NuSieve 3:1 agarose (Lonza). 5 µg RNA was denatured for 10 min at 70 °C with 1 X MOPS buffer (20 mM MOPS ...
-
bioRxiv - Microbiology 2021Quote: ... cells were overlaid with 1:1 mixture of 2% agarose (Lonza, Basel, Switzerland) and 2X MEM medium ...
-
bioRxiv - Bioengineering 2023Quote: Ha deposition was detected staining constructs sections (n≥10 from n≥3 chambers considering two different hACs and two different MSCs donors) with OsteoImage (Lonza) as detailed above ...
-
bioRxiv - Biophysics 2021Quote: ... 2mM L-Glutamine (Lonza, Cat N.: BE17-605E) and 1% Penicillin/Streptomycin (Lonza ...
-
bioRxiv - Cancer Biology 2023Quote: SCM preparation: MEBM (Lonza, cat. n. CC-3153) was supplemented with 1% Penicillin/Streptomycin (100 U/ml) ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells were split at a 1:2 ratio every 2 days by trypsinization (Lonza cat# CC-5012), followed by centrifugation at 200 x g for 3 min before resuspending and reseeding in EBM Basal Medium supplemented with the EGM Singlequots Supplement Pack ...
-
bioRxiv - Cell Biology 2022Quote: ... BUB-1 and CLS-2::GFP production was performed in 2 L SF9 cells in Insect-XPRESS (Lonza) medium (1×10^6 cells/mL) ...
-
Measuring adaptation dynamics to hydrogen peroxide in single human cells using fluorescent reportersbioRxiv - Cell Biology 2020Quote: ... 1% L-glutamine (2 mM) and 1% (v/v) penicillin-streptomycin (100 IU/ml) (Lonza). Cell cultures are maintained at 37°C in a humidified atmosphere containing 5 % CO2 (v/v) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2×10E6 ME-1 cells were nucleofected with CRISPR/Cas9 plasmids (2 μg each) using Nucleofector Technology (Lonza Biologics) with the program X-01 and Amaxa Cell Line Nucleofector Kit V ...
-
bioRxiv - Developmental Biology 2023Quote: ... MVECs were expanded and grown on 1% gelatin-coated dishes in endothelial basal medium-2 (EBM-2 (Lonza; 3156) with 10 % heat-inactivated FBS (Gibco) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Stable LBH-overexpressing BT549 cell lines were generated by nucleofection of 2×106 BT549 cells with 2 μg linearized pCDNA3 or pCDNA3+Lbh 13 and 1 μg pEGFP (Lonza) in Solution V (Lonza) ...
-
bioRxiv - Immunology 2021Quote: ... HUVEC cells were cultured on a 1% gelatin coated surface in EGMTM-2 Endothelial Cell Growth Medium-2 BulletKitTM (Lonza) following the manufacturer’s instructions with an additional 6% FBS ...
-
Cancer-associated fibroblasts produce matrix-bound vesicles that influence endothelial cell functionbioRxiv - Cancer Biology 2023Quote: ... HUVECs and HMVECs were cultured on 1% gelatin coated dishes in EGM-2 or EGM-2 MV (Lonza, Basel, Switzerland), respectively ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 mg Cas9-gRNA-2 plasmid and 1 mg eGFP-puromycin resistance plasmid using the Amaxa 4D-Nucleofector system (Lonza) according to the manufacturer’s instructions with a pulse load of CA137 ...
-
bioRxiv - Bioengineering 2020Quote: ... The cell suspension contained a 2:1 ratio of GFP-HUVECs (Lonza) and HDFs ...
-
bioRxiv - Microbiology 2023Quote: ... The RNA was loaded onto a 2% NuSieve 3:1 agarose (Lonza), 1X MOPS ...
-
bioRxiv - Cell Biology 2024Quote: ... These cells are mantained in 30% FBS/1% antibiotic/antimycotic /1% Non-essential AA/ EGM-2 media (Lonza) with Laminin521 coating (5 μg/ml ...
-
bioRxiv - Genomics 2020Quote: ... The first consisted of 2 μl/well pmaxGFP DNA (LONZA,1 μg/ul) diluted in 250 μl/well Opti-MEM® medium (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... were coated overnight at 4°C with 25μL of SEC fractions 1 to 5 diluted 1:2 with PBS (Cat. No. LZBE17-512F, Lonza). Wells were washed with 0.05% Tween-20 (Cat ...
-
bioRxiv - Microbiology 2020Quote: ... 10 μg of RNA were fractionated on a 2% NuSieve 3:1 agarose (Lonza), 1X MOPS ...
-
bioRxiv - Bioengineering 2020Quote: ... Fluidic lines were coated with 1% gelatin which was replaced by EGM-2 (Lonza) for up to 24 hours ...
-
bioRxiv - Microbiology 2024Quote: ... 10 μg of RNA were fractionated on a 2% NuSieve 3:1 agarose (Lonza), 1X MOPS ...
-
bioRxiv - Microbiology 2023Quote: ... 10 μg of RNA were fractionated on a 2% NuSieve 3:1 agarose (Lonza), 1X MOPS ...
-
bioRxiv - Cell Biology 2023Quote: HUVECs were grown on 1% gelatin-coated plates in EGM-2 medium (Lonza: CC3156) for 48 hrs ...