Labshake search
Citations for Lonza :
1901 - 1950 of 2302 citations for 7 Oxabicyclo 4.1.0 hept 3 ene 2 5 dione 3 hydroxymethyl 4 1E 1 penten 1 yl 1S 6R since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... Four wells of EBs per line were seeded in a 4-layer cell discs coated with growth factor-reduced matrigel in X-VIVO15 medium (Lonza) supplied with GlutaMAX (Gibco) ...
-
bioRxiv - Systems Biology 2024Quote: ... 20 µL of cell suspension was then gently mixed with each crRNP and aliquoted into a 96-well electroporation cuvette for nucleofection with the 4-D Nucleofector X-Unit (Lonza) using pulse code EO-120 ...
-
bioRxiv - Neuroscience 2024Quote: ... 500 pmol Cas12 crRNA (GGAAAAGTAAAAGATGTCTGAAT, IDT) and 20 μg recombinant Cas12 (IDT) using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) and 4D-Nucleofector X unit (Lonza ...
-
bioRxiv - Cancer Biology 2021Quote: ... It was grown at 37°C in 5% CO2 in Eagle’s Minimum Essential Medium (EMEM, Lonza, Allendale, NJ) supplemented with 10% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Molecular Biology 2021Quote: Human and mouse fibroblasts were cultured at 37°C and 5% CO2 in Dulbecco’s modified Eagle’s medium (Lonza) with high glucose supplemented with 10% foetal bovine serum ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 × 106 trypsinized cells were resuspended in 93.5 µl solution (mouse ES cell nucleofector kit, VPH-1001, Lonza). The solution includes 2 µg of each CRISPR/Cas9 vector (4 µg total ...
-
bioRxiv - Cell Biology 2022Quote: ... were cultivated at 37°C with 5% CO2 in DMEM (Dulbecco’s Modified Eagle’s Medium, Lonza Cat. #BE12-614F) with 10% fetal bovine serum albumin (Gibco ...
-
bioRxiv - Biochemistry 2020Quote: Chinese hamster ovary DG-44 cells (Thermo Fischer Scientific) were cultured in the ProCHO 5 medium (Lonza, Switzerland), supplemented by 4 mM glutamine ...
-
bioRxiv - Cell Biology 2020Quote: ... and HEK293 cells expressing mouse TRPV2 in a stable manner were grown at 37 °C with a 5% CO2 humidified atmosphere in Dulbecco’s Modified Eagle’s Medium (DMEM, Lonza). The DMEM was supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Bioengineering 2020Quote: ... 5 wt% polymer solutions were created by dissolving lyophilized GelMA in phosphate buffered saline (PBS; Lonza, 17-516F) at 37°C ...
-
bioRxiv - Cell Biology 2021Quote: ... Individual nuclei of G1 cells were sorted directly into 5 μL freezing buffer (50% PBS, 7.5% DMSO, and 42.5% 2X ProFreeze-CDM [Lonza]) in 96-well plates using a FACSJazz cell sorter (BD Biosciences) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 15 μg Tir1 targeting vector and 5 µg of pX330-EN1201) and transferred to a single Nucleocuvette (Lonza). Nucleofection was performed using the protocol CG110 ...
-
bioRxiv - Molecular Biology 2024Quote: ... were incubated at 37°C in a 5% CO2 humidified atmosphere and propagated in Dulbecco’s modified Eagle’s medium (DMEM; Lonza) supplemented with 10% fetal bovine serum ...
-
bioRxiv - Biochemistry 2023Quote: ... were incubated at 37°C in a 5% CO2 humidified atmosphere and propagated in Dulbecco’s modified Eagle’s medium (DMEM; Lonza) supplemented with 10% fetal bovine serum ...
-
bioRxiv - Cell Biology 2023Quote: Human mammary epithelial cells (HMECs) were cultured at 37°C with 5% CO2 in MEBM basal medium (Lonza) supplemented with MEGM SingleQuots (Lonza ...
-
bioRxiv - Molecular Biology 2023Quote: ... and maintained in Roswell Park Memorial Institute (RPMI) 1640 Medium by adding 5% fetal bovine serum (FBS, Lonza), 2 mM L-glutamine ...
-
DTX3L and USP28 fine-tune DNA double strand repair through mutual regulation of their protein levelsbioRxiv - Biochemistry 2023Quote: ... and SSA (5’EGFP/HR-EGFP) were introduced by nucleofection according to the Amaxa protocol (Lonza, Cologne, Germany). To balance the DNA amount and to control transfection efficiencies ...
-
bioRxiv - Immunology 2023Quote: ... and nucleofected with 5 μg of a plasmid using program X-001 in the Nucleofector IIb device (Lonza) according to the manufacturer’s procedure ...
-
bioRxiv - Immunology 2023Quote: ... The MPRA vector library was nucleofected into TPP macrophages (5µg vector into 5×106 cells) in 100μl nucleofection buffer (Human Macrophage Nucleofection Kit, Lonza) using a Nucleofector 2b (program Y-011) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were stored in humidified incubators at 37 °C with 5% CO2 and routinely checked for mycoplasma (Lonza).
-
bioRxiv - Cell Biology 2020Quote: ... which were maintained using FGM-2 culture medium and protocols provided by the manufacturer (Lonza Inc.). For visualization purposes ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were detached using TrypLE Express and co-cultured in EGM-2 media (Lonza# CC-3162) in different combinations for additional 60 hours as described in Supplemental Figure 8A-H.
-
bioRxiv - Bioengineering 2019Quote: ... Universal Endothelial Medium was DMEM/F12 supplemented with EGM-2 Lonza Bullet Kit (Lonza, Basel, Switzerland), 0.5% FBS ...
-
bioRxiv - Cancer Biology 2019Quote: ... while HUVEC cells were cultured for up to 6 passages in EGM-2 media (Bulletkit, Lonza) comprising all components ...
-
bioRxiv - Cancer Biology 2020Quote: ... Primary human skeletal muscle myoblasts (HSMMs) were cultured in growth medium (SkGM-2 Bullet Kit, Lonza). HEK293T cells (kindly gifted by Slimane Ait-Si-Ali lab ...
-
bioRxiv - Cell Biology 2020Quote: Live cells plated on glass coverslips were fixed with 2% paraformaldehyde (Acros Organic) in PBS (Lonza) for 20 minutes at room temperature ...
-
bioRxiv - Immunology 2021Quote: ... NIH) in 100 µl IMDM/Glutamax/10% FBS containing 2× MycoZap Plus-PR (Lonza #VZA-2021), 100 ng/ml human IL-2 (GoldBio #1110-02-50) ...
-
bioRxiv - Bioengineering 2020Quote: ... ECs were suspended in EGM™-2 Endothelial Cell Growth Medium (Lonza,Basel, Switzerland CC-3162). Cells were cultured on 10 % matrigel coated microchannels and maintained in a humidified CO2 incubator at 37 °C and 5% CO2 ...
-
bioRxiv - Cell Biology 2021Quote: ... young adult worms were placed on a thin layer of 2% agarose (Lonza, SeaKem LE agarose) on a 24 × 55-mm coverslip (Matsunami) ...
-
bioRxiv - Cell Biology 2021Quote: ... Young adult worms were placed on a thin layer of 2% agarose (Lonza, SeaKem LE agarose) prepared on a 24 × 55-mm coverslip (Matsunami) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... inactivated trypsin by adding 2 volumes of medium (500 ml DMEM (Lonza, Catalog no. BE12-733F), 55 ml FBS (PAN ...
-
bioRxiv - Cell Biology 2021Quote: ... LECs were cultured using the EGM2-Endothelial cell growth medium-2 bullet kit (Lonza, Basel, Switzerland). Cells up to 6 passages were used in in vitro experiments ...
-
bioRxiv - Molecular Biology 2021Quote: ... at a confluence of 80-90% were incubated for 24 hours with EBM-2 medium (Lonza) containing 1% FBS (Gibco ...
-
bioRxiv - Cancer Biology 2020Quote: ... Endothelial cells (104 cells/well) were treated with compounds in fully supplemented EGM-2 medium (LONZA) for 48 h and then analyzed as above.
-
bioRxiv - Bioengineering 2022Quote: ... as described before.[29] They were cultured in EBM™-2 basal medium (LONZA, CC-3156) that was supplemented with EGM™-2 SingleQuots™ supplements (LONZA ...
-
bioRxiv - Pathology 2024Quote: ... Glomerular and proximal tubular samples were plated in EGM-2 medium (CC-3162, Lonza, Walkersville, MD) and placed in a CO2-incubator for 30 minutes for the attachment.
-
bioRxiv - Bioengineering 2024Quote: ... cells were treated with various concentrations of BMP-2 or FK506 in an osteogenic media (Lonza). Cell culture medium was changed every 3 days ...
-
bioRxiv - Bioengineering 2024Quote: ... they were treated with various concentrations of BMP-2 or FK506 in an osteogenic media (Lonza). The medium was replaced every 3-4 days ...
-
bioRxiv - Immunology 2024Quote: ... an electroporation reaction consisted of 2 × 105 HEK293T cells in 20 μL of SF buffer (Lonza) and 2 μL of 20 μM Cas9 RNP (equivalent to 40 pmol final concentration) ...
-
bioRxiv - Immunology 2024Quote: ... NIH) in 100 µL IMDM GlutaMAX/ 10% FBS containing 2× MycoZap Plus-PR (Lonza #VZA-2021), 100 ng/mL human IL-2 (GoldBio #1110-02-50) ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were embedded in a YEA medium solidified with 2% low melting temperature agarose (Lonza, #50101) on a polylysine-coated glass bottom dish (Matsunami ...
-
bioRxiv - Neuroscience 2023Quote: ... and the cell pellet resuspended in 2 ml of ACK lysing buffer (Lonza, Cat# 10-548E). After centrifugation ...
-
bioRxiv - Cell Biology 2023Quote: ... then the medium was replaced with hLSEC medium [EGM-2-MV microvascular endothelial cell medium (Lonza) supplemented with 50ng/mL recombinant human vascular endothelial growth factor-A (VEGF-A ...
-
bioRxiv - Immunology 2023Quote: ... with 0.05 mL blocking buffer (98% v/v FACS buffer (PBS + 2% v/v dFBS (Lonza)) and 2% v/v Fc receptor binding inhibitor (Thermo Fisher Scientific)) ...
-
bioRxiv - Immunology 2023Quote: ... 2 samples of 5x106 PBMCs were nucleofected in 100 mL of P3 buffer (Lonza; V4XP-3024) with 125 pmol of Alt-R Sp HiFi Cas 9 nuclease v3 (IDT ...
-
bioRxiv - Immunology 2023Quote: ... NIH) in 100 µl IMDM/Glutamax/ 10% FBS containing 2× MycoZap Plus-PR (Lonza #VZA-2021), 100 ng/ml human IL-2 (GoldBio #1110-02-50) ...
-
bioRxiv - Biophysics 2023Quote: The pellet of cells after electroporation was mixed with 2 % (w/w) SeaPrep agarose (Lonza, Switzerland) in DMEM at 37°C ...
-
bioRxiv - Bioengineering 2024Quote: ... which directly correlates to cellular metabolic activity.58 LSEC cells were maintained in EBM-2 (Lonza) media with EGM-2 BulletKit (Lonza) ...
-
bioRxiv - Biophysics 2024Quote: ... Young adult worms were placed on a thin layer of 2% agarose (Lonza, SeaKem LE agarose) prepared on a 24 × 55-mm coverslip (Matsunami Glass ...
-
bioRxiv - Molecular Biology 2019Quote: ... 150,000 cells were resuspended in 20 µL of P3 Primary Cell Nucleofector Solution with Supplement 1 and mixed with the gRNA/rCas9 solutions before electroporation (4D-Nucleofector System, Lonza, Walkersville, MD; program DC-100). For experiments involving the Neon Transfection System (Thermo Fisher Scientific) ...