Labshake search
Citations for Lonza :
1851 - 1900 of 5517 citations for Recombinant Human Programmed Cell Death 1 Ligand 2 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... 1*106 purified naïve T-cells were resuspended in 15 μL buffer P3 + 5 μL Supplement 1 (P3 Primary Cell 4D-NucleofectorTM X Kit S; Lonza) and mixed with 2.7 μL RNP in the 16-well strips provided in the kit ...
-
bioRxiv - Immunology 2020Quote: 2×106 freshly isolated primary B cells were washed in PBS and resuspended in 20 μl P3 Primary Cell Nucleofector Solution buffer prepared with Supplement 1 buffer (Lonza) according to the manufacturer’s instructions (P3 Primary Cell 4D-Nucleofector X Kit S) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lung cancer cell lines (H3122, H2228, A549, H460, Calu-1, and H1437) were cultured in RPMI-1640 (Lonza, 15-1675) supplemented with 10% FBS ...
-
bioRxiv - Immunology 2021Quote: ... The enriched CD4+CD25hi cells were cultured in 24-well non-tissue culture plates at 1 x 106 cells/mL in X-Vivo-15 (Lonza) supplemented with 10% heat-inactivated human AB serum (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: African green monkey kidney epithelial BSC-1 cells (ATCC CCL-26) were maintained in Eagle’s minimal essential medium (EMEM; Lonza, Inc.) containing 5% fetal bovine serum (FBS ...
-
bioRxiv - Developmental Biology 2022Quote: ... the cells were nucleofected with 1 nmol ASO against MERVL or Scramble ASO using P3 Primary Cell 96-well Nucleofector Kit (Lonza) according to manufacturer’s instruction and seeded into each well of a 24-well plate containing 500 µl of ESC medium with 2i ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were plated at 1 × 104/well in black 96-well plates using Bio Whittaker HBSS (BE10-527F, Lonza, Switzerland) with 4.5 g/L glucose ...
-
bioRxiv - Cancer Biology 2022Quote: ... and resuspended in a mixture of 16.4 µl SF cell line solution and 3.6 µl supplemental solution-1 (Lonza, V4XC-2032). The sgRNA and Cas9 ribonuclease protein complex under incubation was then mixed with the cell suspension and 20 µl of it was put a cuvette and nucleofected using 4D-Nucleofector (Lonza ...
-
bioRxiv - Biochemistry 2022Quote: ... Baculoviral P3 stock was used to infect Sf9 insect cells at 1.5 × 106 cells·mL-1 in Insect-XPRESS media (Lonza #12-730Q) supplemented with 2% FBS (Capricorn #FBS-12A) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 × 106 wild-type K562 cells were electroporated in 100 μl of Amaxa solution (Lonza Nucleofector 2b, program T-016) with 1 µg of PiggyBac expression vector (PB200A-1 ...
-
bioRxiv - Cell Biology 2024Quote: ... together with a plasmid encoding the piggyBac transposase in a 3:1 ratio (vector:transposase) using the P3 Primary cell 4D-Nucleofector™ kit (Lonza). Prior to targeting ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were passaged 1:10 every 3-4 days by trypsinisation and were regularly screened for mycoplasma contamination (Mycoalert, Lonza).
-
bioRxiv - Immunology 2024Quote: Ten micrograms of expression plasmid or 20 pmol of siRNA were introduced into 1 x 107 BMDC cells by electroporation using a Nucleofector 2b (Lonza) with an Amaxa Mouse Dendritic Cell Nucleofection Kit (Lonza) ...
-
bioRxiv - Immunology 2024Quote: ... The reaction contained 400 pmol of Cas9 protein and 1 × 107 of the transduced NK cells in 100 µL of P3 solution (Lonza). Immediately after electroporation ...
-
bioRxiv - Immunology 2023Quote: ... CTLs derived from LifeAct-GFP expressing pmel-1 mice were incubated with peptide-loaded and IFNγ-treated B16 cells cultured in phenol red-free DMEM (Lonza) supplemented with 10% FBS on stage at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... Knock-down procedures were performed with siRNA purchased from Riboxx (non-targeting siRNA: UUGUACUACACAAAAGUACCCCC; US10 targeting #1: UUCUGAAUAACACAGCCGCCCCC) applying the SE Cell Line Kit (Lonza) for fibroblasts and Lipofectamine RNAiMax (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: Cell and organoid lines were generated from C3-TAg tumors (supplementary file 1) and tested for mycoplasma (Lonza, LT07-703) prior to use and the creation of frozen stocks ...
-
bioRxiv - Neuroscience 2023Quote: ... and the ssODN (1 μl; stock 100 μM, IDT) in 20 μl of nucleofection buffer P3 (P3 Primary Cell NucleofectorTM Solution, Lonza) were nucleofected (program CA137 ...
-
bioRxiv - Bioengineering 2024Quote: ... B cells were edited 3-5 days after isolation or thawing using the Lonza Nucleofector 4D (program EO-117) using 1×106 cells per well of a 16-well Nucleocuvette Strip (Lonza). Immediately following nucleofection ...
-
bioRxiv - Physiology 2019Quote: ... 10% AIM-V and 100 units/ml penicillin/ streptomycin and transiently transfected using Nucleofector™ Kits for Human Melanocytes (Lonza) or magnetofection with PolyMag Neo magnetic beads (OZ Biosciences) ...
-
bioRxiv - Genetics 2019Quote: ... Electroporation was performed using the Human Adult Dermal Fibroblast Nucleofector™ Kit and the Nucleofector™ II/2b device (Lonza). Both cell lines were harvested 72-hours post-transfection for qRT-PCR ...
-
bioRxiv - Molecular Biology 2022Quote: ... and human ACTB (assay control, primer composition not disclosed by manufacturer) were loaded on a 2.5% agarose gel (Lonza, 50010) and stained with GelRed® (Merck ...
-
bioRxiv - Cell Biology 2022Quote: ... and diseased COPD human lung fibroblasts (DHLFs) from 3 donors (donor IDs: OF3353, OF3418 and OF3238) were purchased from Lonza and tested for their response to FGF2 and TGFβ stimulation.
-
bioRxiv - Cancer Biology 2022Quote: ... siControl and siIRAK4 were purchased from Horizon Discovery and transfected into human AML samples using Amaxa Nucleofector Kit T (Lonza) (program number G-016 ...
-
bioRxiv - Physiology 2022Quote: ... All human iPSC lines were negative for mycoplasma contamination as tested using the Mycoalert Mycoplasma testing kits (LT07-318, Lonza) and no karyotype abnormalities were found (KaryoStat+ ...
-
bioRxiv - Genomics 2020Quote: Primary human dermal LECs and BECs were isolated from neonatal human foreskin as described previously88 and cultured in endothelial basal medium (EBM, Lonza) supplemented with 20% FBS ...
-
bioRxiv - Molecular Biology 2024Quote: ... All cell lines used are of human origin and were confirmed negative for mycoplasma before experimental use by using the MycoAlert Mycoplasma Detection Kit (Lonza) according to the the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: All cell lines used are of human origin and were confirmed negative for mycoplasma before experimental use by using the MycoAlert Mycoplasma Detection Kit (Lonza) according to the manufacturer’s specifications.
-
bioRxiv - Immunology 2024Quote: ... and primary human monocytes and placed in nucleofection cuvettes subjected to program Y-010 for the Nucleofector 2b Device (Lonza). 500µL RPMI medium was immediately added into cuvettes after nucleofections ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with endothelial growth medium (EGM)-2 SingleQuots (LONZA Clonetics CC-4176) containing human epidermal growth factor (hEGF ...
-
bioRxiv - Biophysics 2019Quote: ... Cat#354277)-coated dishes in skeletal muscle growth media (SKGM-2, Lonza CC-3245) with 10 μM ROCK inhibitor.44 After 24 hours ...
-
bioRxiv - Bioengineering 2019Quote: ... Chip medium was prepared by adding EGM-2 SingleQuot bullet kit (Lonza) to DMEM/F12 (Lifesciences) ...
-
bioRxiv - Bioengineering 2020Quote: ... passage 3-5 AFC were dissociated and resuspended in EGM-2 (Lonza) at 4×105 cells/mL ...
-
bioRxiv - Neuroscience 2020Quote: ... reprogramming was performed on passage 2 fibroblasts by nucleofection (Lonza Amaxa Nucleofector) with episomal vectors expressing OCT4 ...
-
bioRxiv - Cell Biology 2020Quote: ... Cat#354277)-coated dishes in skeletal muscle growth media (SKGM-2, Lonza CC-3245) with 10 μM ROCK inhibitor ...
-
bioRxiv - Microbiology 2022Quote: ... supplemented with 2 mM L-glutamine (cat # BE17-605E, Lonza, Basel, Switzerland), 100 U/ml penicillin and 100 μg/mL streptomycin (cat # DE17-602E ...
-
bioRxiv - Neuroscience 2022Quote: ... #CLU512) and cultured in endothelial basal medium (EBM-2; Lonza, cat. #190860) supplemented with 10% (v/v ...
-
bioRxiv - Bioengineering 2022Quote: ... 750μL of endothelial growth media (EGM-2, CC-3162, Lonza, Basel, Switzerland) was added to the well and COL1 was incubated in media for 24 hours before seeding cells ...
-
bioRxiv - Bioengineering 2022Quote: ... were cultured in EBM-2 Basal Medium (Lonza Bioscience, Walkersville, MD, USA) supplemented with EGM-2 Endothelial Cell Growth Medium-2 BulletKit (Lonza Bioscience ...
-
bioRxiv - Biophysics 2021Quote: ... with the addition of EGM-2 MV Bullet Kit (Lonza CC-4147), with the exception of gentamicin ...
-
bioRxiv - Cancer Biology 2019Quote: ... HUVECs were cultured with EGM-2 bullet kit media (#cc-3162, Lonza) with 1X antibiotic-antimycotic (#15240062 ...
-
bioRxiv - Molecular Biology 2019Quote: ... and grown in Endothelial Medium Bullet Kit (EGM-2, Lonza, CC-3162). For viral production ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Dulbecco’s Modified Eagle medium (DMEM) and EBM-2 were purchased from Lonza. FluoForte™ Kit was purchased from Enzo Life Sciences ...
-
bioRxiv - Cell Biology 2020Quote: ... Cat#354277)-coated dishes in skeletal muscle growth media (SKGM-2, Lonza CC-3245) with 10 μM ROCK inhibitor (#1254 ...
-
bioRxiv - Bioengineering 2021Quote: HUVECs were expanded on 2D flasks in EGM-2 (Lonza, CC-3162) or ECGM (Provitro 211 1101) ...
-
bioRxiv - Genomics 2020Quote: ... coated plates and were cultured in EGM-2-MV complete medium (Lonza). After 7-10 days ...
-
bioRxiv - Neuroscience 2020Quote: ... PCR products were resolved on 2% high-resolution Metaphor agarose gels (Lonza).
-
bioRxiv - Microbiology 2022Quote: ... Virus was removed and 2 mL of overlay media (EMEM 1X Lonza 12-684F ...
-
bioRxiv - Microbiology 2022Quote: Transfection was performed using the Amaxa Basic Parasite Nucleofector Kit 2 (LONZA). All transfectants were selected by treating mice with 70 μg/mL pyrimethamine in their drinking water ...
-
bioRxiv - Immunology 2022Quote: ... culture flasks in growth medium (EGM-2 MV medium (Lonza, Basel, Switserland) supplemented with 2.5% fetal bovine serum (FBS ...