Labshake search
Citations for Lonza :
1851 - 1900 of 1994 citations for Allopregnanolone ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... OC activity was measured by releasing the europium conjugated human Type I collagen-coated on the bottom of the OsteoLyse™ Assay Kit (Lonza Biosciences) at each time point ...
-
bioRxiv - Cell Biology 2021Quote: ... We transfected the KCNQ1 constructs and the empty vector into our established mouse pancreatic β cells (referred to as SJ β cells (Jia et al., 2015)) using AmaxaTM Cell Line NucleofectorTM Kit V and AmaxaTM NucleofectorTM 2b device (Lonza, Switzerland). The glucose-sensitive mouse β-cell line SJ-β was cultured and an insulin-secretion assay performed as reported earlier (Jia et al. ...
-
bioRxiv - Systems Biology 2021Quote: ... freshly isolated neurons (5 million cells per nucleofection reaction) were transfected using the 4D-Nucleofector™ X Unit and the P3 Primary Cell 4D Nucleofector X kit (Lonza, Switzerland), as indicated ...
-
bioRxiv - Cell Biology 2020Quote: ... These plasmids were transfected into NHDFs and 7SPs by electroporation using the Amaxa nucleofector kit and nucleofector 2b (Lonza, Walkersvill, MD, USA). Two days later ...
-
bioRxiv - Cancer Biology 2021Quote: ... All human cell lines were authenticated by Short Tandem Repeat analysis and tested for Mycoplasma contamination with a MycoAlert Mycoplasma Detection Kit (Lonza, Basel, Switzerland).
-
bioRxiv - Cancer Biology 2021Quote: ... AsPC-1 and CAPAN-1 pellets were suspended in Lonza transfection reagent (SE Cell Line 4D-Nucleofector™ X Kit L, Lonza, Germany) when the Mirus transfection reagent was finished ...
-
bioRxiv - Cell Biology 2021Quote: ... 500μg of gRNA and 500μg of donor plasmids were electroporated in 1×106 mESC using P3 Primary Cell 96-well Nucleofector™ Kit (Lonza, PBP3-22500) according to manufacturer’s instruction ...
-
bioRxiv - Genomics 2022Quote: ... 8 million cells were transfected with 20ug of plasmid DNA in one 100- uL cuvette using the Amaxa® Cell Line Nucleofector® Kit V (Lonza), program X-001 ...
-
bioRxiv - Genomics 2022Quote: ... 5 million cells were transfected with 10ug of plasmid DNA in one 100- uL cuvette using the Amaxa® Cell Line Nucleofector® Kit T (Lonza), program X-001 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Electroporation of 5×106 HL-60 cells was performed with AIO-GFP HAX1 LCRC1 and AIO-GFP HAX1 LCRC2 using CLB-Transfection™ Kit (Lonza, Austria) and CLB-Transfection™ System (Lonza ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell lines were cultures for no more than 30 passages and routinely tested for mycoplasma contamination using MycoAlert Mycoplasma Detection Kit (Lonza, Slough, UK).
-
bioRxiv - Microbiology 2022Quote: ... 1.2E6 BHK21 cells were nucleofected with 2 µg of Spike plasmid using an Amaxa Nucleofector II with cell line kit L (Lonza #VCA-1005) and program A-031 ...
-
bioRxiv - Neuroscience 2022Quote: ... All cell lines were verified to be mycoplasma free by first culturing the cells in antibiotic-free media and then subjected to a mycoplasma tested using MycoAlert™ PLUS Mycoplasma Detection Kit (Lonza, UK).
-
bioRxiv - Biophysics 2022Quote: ... 106 U2OS cells were transfected with 1 μg of px330 plasmid and 1 μg of the HDR donor plasmid using the Nucleofector 2b device and cell line nucleofector kit V (Lonza, VCA-1003) per manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... 1uM siRNA was electroporated into cells using the Amaxa Nucleofector II device and Cell Line Nucleofector Kit V (Lonza Bioscience, VCA-1003). B16-F10 cells were electroporated with program P-020 ...
-
bioRxiv - Microbiology 2020Quote: ... cell lines were authenticated using STR profiling (Eurofins Genomics) and monitored for mycoplasma contamination using the MycoAlert mycoplasma detection kit (Lonza Rockland, USA). Cells were cultured at 37 °C and 5 % CO2 in Dulbecco’s Modified Eagle’s Medium (DMEM ...
-
bioRxiv - Molecular Biology 2020Quote: ... Point mutations were introduced into CJ7 WT using CRISPR RNP transfected into cells with the Amaxa mouse ES kit (Lonza VPH-1001). 1×106 cells were transfected with the RNP containing two separate guide RNAs a single stranded donor oligo and a linearized puromycin resistance gene ...
-
bioRxiv - Immunology 2020Quote: ... 106 cells per condition were nucleofected with 4 µg of DNA using the Amaxa Nucleofector II (Lonza, Kit R; program R-024). Nucleofected cells were allowed to recover for 24-48 hours before sorting for GFP positivity and lack of CD56 expression.
-
bioRxiv - Microbiology 2021Quote: ... the Sleeping Beauty transposase system [37] was adapted to electroporate Jurkat cells using the Lonza SE Cell Line kit (Lonza, V4SC-1960). The pSBbi-RP plasmid was a gift from Eric Kowarz (Addgene plasmid #60513 ...
-
bioRxiv - Cell Biology 2022Quote: ... Cell lines are cultivated at 37°C with 5% CO2 and were tested every 3 months for mycoplasma contamination using Universal Mycoplasma detection kit (ATCC, 30-1012K) or MycoAlert Plus Mycoplasma Detection Ki (Lonza, LT07-701). Cell lines were used no more than 30 passages.
-
bioRxiv - Immunology 2019Quote: ... conjugated to FITC or GFP siRNA (300 nM) conjugated to FITC two days prior to adoptive T cell therapy using the Mouse T cell Nucleofector™ Kit (Lonza Bioscience) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2019Quote: ... as a control two days prior to adoptive T cell therapy using the P3 Primary Cell 4D-Nucleofector X™ Kit (Lonza Bioscience) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2019Quote: ... 2×105 cells were co-transfected with 2ug of the Cas9/sgRNA vector PxHF1* and 4 ul of ssODN HDR template (20 uM) using a Lonza X-Unit Nucleofector with P3 buffer kit (Lonza #V4XP-3032). Four days following transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... and the GFP-K17ΔNLS (Hobbs et al., 2015) were nucleofected into HeLa cells using SE Cell Line 4D X nucleofector Kit S (Lonza #V4XC-1032) with setting DS-138 ...
-
bioRxiv - Microbiology 2021Quote: ... All cell lines were routinely tested for the absence of mycoplasma using the MycoAlert Plus Mycoplasma Detection Kit from Lonza (Walkersville, MD).
-
bioRxiv - Neuroscience 2020Quote: ... 500 µl of cell media was collected and the presence of adenylate kinase was measured with the ToxiLightTM cytotoxicity assay kit (Lonza, Basel, Switzerland) to check the integrity of the cell membrane ...
-
bioRxiv - Immunology 2020Quote: ... Transfection of primary T cells with Cas9 RNP complexes and TCRβα HDR templates was performed 3-4 days following activation using the 4D-Nucleofector and a 20 uL format P3 Primary Cell kit (Lonza, V4XP-3032). Briefly ...
-
bioRxiv - Microbiology 2019Quote: ... Fast-growing clonal cell lines confluent after three weeks of growth were expanded and confirmed to be mycoplasma-negative using the Myco-Alert PLUS kit (Lonza, Basel, Switzerland) prior to freezing for long-term storage in liquid nitrogen ...
-
bioRxiv - Microbiology 2019Quote: ... All parasite strains and host cell lines were routinely tested for Mycoplasma contamination with the MycoAlert Mycoplasma Detection Kit (Lonza, Basel, Switzerland) and found to be negative.
-
bioRxiv - Evolutionary Biology 2020Quote: ... plasmids pSpCas9n(BB)-ZEB2-Guide-A &-B (0.5 µg of each plasmid) were electroporated into 1×106 H9 cells using the Human Stem Cell Nucleofector Kit 1 (Lonza, VPH-5012). Following electroporation ...
-
bioRxiv - Molecular Biology 2020Quote: pSBbi-Pur-ABCC1 or empty vector were cotransfected with SB100X using the same Amaxa Nucleofector II and kit V (Lonza Group AG). Stably expressing cells were selected for using 10ug/mL puromycin (Gibco) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were transfected with pcDNA3.1 empty vector or pcDNA3.1 containing the human coding sequence of the VGLL2-NCOA2 fusion using the AMAXA cell line Nucleofection kit V (Lonza #VCA-1003;) and were selected in growth media containing 1μg/ml concentration of G418 (ThermoFisher #10131035) ...
-
bioRxiv - Biophysics 2021Quote: ... All cell lines were regularly tested for mycoplasma infection and were found to be negative (MycoAlert Plus Detection Kit, Lonza, LT07-710).
-
bioRxiv - Immunology 2021Quote: ... gRNA_pX335 plasmids were transfected into EL4 cells by nucleofection using an Amaxa nucleofector and the Cell Line Nucleofector Kit L (Lonza, Basel, Switzerland) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... 2 million L1.2 cells were transfected with 2 µg of plasmid using the SG Cell Line transfection kit and a 4D-Nucleofector X (both from Lonza, Walkersville, MD) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... 1 × 106 BLaER1 cells were transfected with 2 μg plasmid DNA using the Human B Cell Nucleofector Kit and Nucleofector I device (program U-15; both Lonza, Basel, Schweiz). On day 2 post transfection ...
-
bioRxiv - Microbiology 2021Quote: ... All cell lines were routinely tested to confirm absence of mycoplasma using the MycoAlert Plus Mycoplasma Detection Kit from Lonza (Walkersville, MD).
-
bioRxiv - Genomics 2021Quote: ... transfection of primary T cells with Cas9 RNP complexes and GSH1/GSH2-mRuby HDR templates was performed using the 4D-Nucleofector and a 20 uL format P3 Primary Cell kit (Lonza, V4XP-3032). Briefly ...
-
bioRxiv - Neuroscience 2020Quote: ... Single iPSCs were then nucleofected with the pX459v2 plasmid coding for the Cas9 protein and the sgRNA using P3 primary Cell 4D nucleofector kit (Lonza, V4XP-302). After nucleofection cells were plated on a 6-well plate in E8 flex medium supplemented with RevitaCell ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cells were co-transfected with 1 ug of firefly Luciferase vector and 0.1 ug Renilla luciferase vector by nucleofection with Lonza Cell Line Nucleofector® Kit V (Lonza, #VVCA-1003) and the T-020 program in the Amaxa Nucleofector II device ...
-
bioRxiv - Bioengineering 2022Quote: Cell cultures were monitored for the presence of mycoplasma contamination using the MycoAlert® Mycoplasma Detection Kit (Lonza #LT07-318, Basel, Switzerland) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: Normal bronchial epithelial cells (BEAS-2B / ATCC-CRL-9609) were cultured in collagen coated flasks using the bronchial epithelial growth medium supplemented with Lonza Bullet Kit (BEGM, Lonza CC-3170), as described by ATCC culture instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... The plasmids were co-transfected into H9 hESC cells using the Amaxa 4D nucleofector (#AAF-1003B and #AAF-1003X) and the P3 Primary Cell 4D-Nucleofector X kit (Lonza, #V4XP-3024).
-
bioRxiv - Molecular Biology 2022Quote: ... using nucleofection with the Amaxa 4D-Nucleofector X-Unit and the P3 Primary Cell 4D-Nucleofector X Kit (Lonza, V4XP-3024 KT). 2×106 cells were harvested using accutase (Sigma Aldrich ...
-
bioRxiv - Molecular Biology 2022Quote: ... HEK293T cells used in this study were confirmed to be negative for Mycoplasma Contamination and routinely tested using the MycoAlertTM Mycoplasma Detection Kit (Lonza, LT07-418). For experiments involving the SMAD4 gene ...
-
bioRxiv - Synthetic Biology 2022Quote: ... human aortic endothelial cells (CD31+) from were maintained in EGM™-2 Endothelial Cell Growth Medium-2 Bullet Kit™ (Cat # CC-3162; Lonza) and EGM™ −2 MV Microvascular Endothelial Cell Growth Medium-2 Bullet KitTM (Cat #CC-3202 ...
-
bioRxiv - Immunology 2022Quote: LPS concentration in serum was determined using a chromogenic assay based on a Limulus amebocyte extract (LAL kit-terminal QCL1000) (LONZA, Basel, Switzerland). Samples were collected at the time of euthanasia via cardiac puncture to try to minimize as much as possible the chance of contamination ...
-
bioRxiv - Developmental Biology 2023Quote: ... ePB master vector and helper (Plasmid AW-27) were nucleofected into the established SOX2::mCitrine cell line using the P3 Primary Cell 4D-Nucleofector X Kit (Lonza; V4Xp-3012). G-418 (40ng/mL ...
-
bioRxiv - Developmental Biology 2023Quote: ... and guide RNA (Plasmid AW-P45; GTGCCCGGCACGGCCATTAA) were nucleofected in hPSCs using the P3 Primary Cell 4D-Nucleofector X Kit (Lonza; V4Xp-3012), and positive transformants were selected with blasticidin (10μg/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... The cells used in this study were negatively tested for mycoplasma contamination using MycoAlert™ Mycoplasma Detection Kit (LT07-118, Lonza, Switzerland).