Labshake search
Citations for Lonza :
1801 - 1850 of 1886 citations for 6H Purin 6 one 1 2 3 9 tetrahydro 3 methyl 2 thioxo since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were plated at 1 × 104/well in black 96-well plates using Bio Whittaker HBSS (BE10-527F, Lonza, Switzerland) with 4.5 g/L glucose ...
-
bioRxiv - Cancer Biology 2022Quote: ... and resuspended in a mixture of 16.4 µl SF cell line solution and 3.6 µl supplemental solution-1 (Lonza, V4XC-2032). The sgRNA and Cas9 ribonuclease protein complex under incubation was then mixed with the cell suspension and 20 µl of it was put a cuvette and nucleofected using 4D-Nucleofector (Lonza ...
-
bioRxiv - Biochemistry 2022Quote: ... Baculoviral P3 stock was used to infect Sf9 insect cells at 1.5 × 106 cells·mL-1 in Insect-XPRESS media (Lonza #12-730Q) supplemented with 2% FBS (Capricorn #FBS-12A) ...
-
bioRxiv - Cell Biology 2022Quote: ... and a gene-edited iPSC homozygous MYBPC3 knock-out (MYBPC3 (-/-)) (Supplemental Table 1).(15–17) iPSCs were verified to be free of mycoplasma contamination using MycoAlert Detection Kit (Lonza). Newly generated lines were karyotyped (WiCell Institute ...
-
bioRxiv - Synthetic Biology 2022Quote: ... T cells were resuspended in P3 buffer (0.75-1 x 106 cells per 18 μl P3) from the P3 Primary Cell 4D-Nucleofector X Kit S (Lonza). 10 μg/μl Alt-R S.p ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were washed once in PBS and then resuspended in 1 ml of ACK Red Blood Cell lysis buffer (Lonza). After washing with PBS ...
-
bioRxiv - Cell Biology 2022Quote: ... Two million of MNCs were transfected with 10 μg of plasmid (5:1 ratio pEB-C5:pEBTg) as instructed by the Lonza CD34+ nucleofector kit (VPA-1003, Lonza) and Amaxa nucleofector (program T-016 ...
-
bioRxiv - Cancer Biology 2023Quote: Cell and organoid lines were generated from C3-TAg tumors (supplementary file 1) and tested for mycoplasma (Lonza, LT07-703) prior to use and the creation of frozen stocks ...
-
bioRxiv - Microbiology 2023Quote: ... Knock-down procedures were performed with siRNA purchased from Riboxx (non-targeting siRNA: UUGUACUACACAAAAGUACCCCC; US10 targeting #1: UUCUGAAUAACACAGCCGCCCCC) applying the SE Cell Line Kit (Lonza) for fibroblasts and Lipofectamine RNAiMax (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... Ribonucleoproteins were introduced into 1 x 106 sub-confluent BLaER1 cells using 4D-Nucleofector X Unit and SF Cell line Kit (Lonza), applying program DN-100 ...
-
bioRxiv - Physiology 2023Quote: ... 2 μl of KCNQ2/3 cDNA plasmid (0.9 g/l) and 1 μl of pmax green fluorescent protein vector (0.5 g/l) (Lonza, Cologne, Germany) were diluted in 125 μl of Opti-MEM medium (Life Technologies) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 100 μL of YEA medium containing 1% (w/v) microwave-heated low-melting point agarose (SeaPlaque agarose, 50101; Lonza) was gently added to the central area ...
-
bioRxiv - Cell Biology 2023Quote: ... were delivered as a ribonucleoprotein complex with the DNA donor template using a Nucleofector 2b Device and the Human Stem Cell Nucleofector Kit 1 (Lonza) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... and the ssODN (1 μl; stock 100 μM, IDT) in 20 μl of nucleofection buffer P3 (P3 Primary Cell NucleofectorTM Solution, Lonza) were nucleofected (program CA137 ...
-
bioRxiv - Neuroscience 2023Quote: ... reprogramming was initiated by nucleofection of 1×105 fibroblast with 1 µg of each episomal plasmid (pCXLE-hUL, pCXLE-hSK and pCXLE-hOCT4) using the Nucleofector 2b (Lonza). Initially ...
-
bioRxiv - Biophysics 2023Quote: ... MCF7 and A375 cells (ATCC) were transfected with 1 μg DNA using the SF Cell Line 4D-Nucleofector kit (Lonza) following the manufacturer’s instructions via electroporation (4D-Nucleofector ...
-
bioRxiv - Immunology 2023Quote: ... CTLs derived from LifeAct-GFP expressing pmel-1 mice were incubated with peptide-loaded and IFNγ-treated B16 cells cultured in phenol red-free DMEM (Lonza) supplemented with 10% FBS on stage at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... and performed nucleofection where 1 × 106 of the selected clone were resuspended in 100 μl of P3 buffer (V4XP-3024, Lonza) containing 20 μg Alt-R® S.p ...
-
bioRxiv - Immunology 2024Quote: Ten micrograms of expression plasmid or 20 pmol of siRNA were introduced into 1 x 107 BMDC cells by electroporation using a Nucleofector 2b (Lonza) with an Amaxa Mouse Dendritic Cell Nucleofection Kit (Lonza) ...
-
bioRxiv - Immunology 2024Quote: ... The reaction contained 400 pmol of Cas9 protein and 1 × 107 of the transduced NK cells in 100 µL of P3 solution (Lonza). Immediately after electroporation ...
-
bioRxiv - Biochemistry 2023Quote: The complete working medium (CWM) was comprised of DMEM (863.6 mL·L−1; Dulbecco’s Modified Eagle Medium; BioWhittaker®; Lonza; Walkersville; USA), foetal Bovine Serum (104.9 mL ...
-
bioRxiv - Bioengineering 2024Quote: ... B cells were edited 3-5 days after isolation or thawing using the Lonza Nucleofector 4D (program EO-117) using 1×106 cells per well of a 16-well Nucleocuvette Strip (Lonza). Immediately following nucleofection ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 x 105 to 1 x 106 cells were resuspended in 20µL of nucleofection solution (P3 Primary Cell 4D-Nucleofector™; Lonza) and nucleofected (Lonza 4D nucleofector TM Core + X Unit ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 × 106 wild-type K562 cells were electroporated in 100 μl of Amaxa solution (Lonza Nucleofector 2b, program T-016) with 1 µg of PiggyBac expression vector (PB200A-1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 × 106 OSCs were transfected with 4 μg of pPB-TRE3G-FLAG-Rhino-Tjen-trTA-P2A-BlastR and 1 μg of pHsp70-Myc-hyPBase using Nucleofector Kit V (Lonza). After incubation in media containing blasticidin (50 μg/mL) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Supernatant was removed and cells were resuspended in P3 Primary Cell Nucleofector® Solution with Supplement 1 (Lonza, V4XP-3032) at 5-15 million cell/mL ...
-
bioRxiv - Bioengineering 2024Quote: ... Beads were mixed at a 1:1 ratio with cells and cells were cultured at a density of 1 x 106 cells/mL in complete X-Vivo 15 culture media (Lonza, 5% fetal bovine serum ...
-
bioRxiv - Cell Biology 2023Quote: ... 2005) using Amaxa Basic Parasite Nucleofector Solution 1 using the X-001 program of an Amaxa Nucleofector II (Lonza, Switzerland). Clones were selected by growth in medium containing phleomycin (2.5 μg/ml ...
-
bioRxiv - Cell Biology 2020Quote: BMDMs (1 × 106 cells) were transfected with siRNA (250 pmol) and Amaxa Mouse Macrophage Nucleofector Kit (Lonza, catalog number VPA-1009) using a Lonza Nucleofector 2b device (Lonza ...
-
bioRxiv - Genomics 2021Quote: ... Four aliquots of one million cells each per study subject were stimulated overnight for 12 hours in 1 ml X-VIVO™ 15 Serum-free Hematopoietic Cell Medium (Lonza) with 10 ul ImmunoCult™ Human CD3/CD28/CD2 T Cell Activator (STEMCELL Technologies) ...
-
bioRxiv - Immunology 2021Quote: ... The frequency of cells producing IFN-γ in responses to antigen was quantified with ELISpot (Diaclone; 2B Scientific, Oxon, U.K.) performed in HL-1 serum-free medium (BioWhittaker; Lonza, Slough, U.K.), supplemented with L-glutamine and penicillin–streptomycin (Life Technologies ...
-
bioRxiv - Plant Biology 2021Quote: ... pollen was collected immediately prior to bombardment and distributed on pollen germination medium solidified with 1% (w/v) NuSieve GTG Agarose (Lonza, Switzerland). Pollen germination media for Nicotiana (Wang and Jiang 2011 ...
-
bioRxiv - Biophysics 2020Quote: ... or in Binding buffer (1% w/v BSA and 25 mM HEPES pH 7.2 in DMEM without phenol red; Lonza Netherlands B.V.) at 4°C in the case of HeLa cells ...
-
bioRxiv - Genomics 2022Quote: ... 20 ng of HMW DNA was run on a 1% agarose gel (Seakem Gold Agarose, Lonza, Rockland, ME, USA, Cat #50150) in 0.5xTBE with the BioRad CHEF Mapper system (BioRad ...
-
bioRxiv - Microbiology 2021Quote: ... The Ala324Thr and the Glu655Asp mutations were independently recreated by transfecting the respective sgRNA template and donor dsDNA using the Basic Parasite Nucleofector™ Kit 1 (Lonza) with the U-033 program following manufacturer recommendations ...
-
bioRxiv - Neuroscience 2021Quote: ... supplemented with 10% of heat-inactivated fetal bovine serum (Biowest™) and 1% of antibiotics (penicillin + streptomycin, Lonza™ BioWhittaker™). One day after plating ...
-
bioRxiv - Genomics 2019Quote: ... DNA fragments underwent PCR-based amplification using Illumina’s Nextera® primers and the resulting libraries were subjected to electrophoresis for the indicated time in 1% agarose gels (Lonza) at 3.0 V cm-1 in TBE buffer (50 mM Tris-borate ...
-
bioRxiv - Genomics 2021Quote: ... K562 cells were grown to a density of 1×106 cells and electroporated with 5μg of plasmid DNA (Amaxa® Cell Line Nucleofector® Kit V, Lonza). Cells from each cell line were cultured for an additional 48 hours until total RNA isolation (Maxwell RSC simplyRNA kit ...
-
bioRxiv - Cell Biology 2020Quote: ... and DMEM with recommended Lonza supplements (1 supplement pack per 500 mL of media) with additional bovine pituitary extract (12.6 μg/mL, Lonza and AthenaES), BSA (final concentration of 1.5 μg/mL ...
-
bioRxiv - Cancer Biology 2021Quote: ... 100 ng/mL and 0.5 µg/mL or 1 µg/mL were used in Mammary Epithelial Growth Medium (Lonza, CC-3150), respectively ...
-
bioRxiv - Immunology 2020Quote: ... After washing cells were plated in 24-well tissue culture plate (0.5 × 106 /ml per well) in DMEM supplemented with 1% penicillin/streptomycin (Lonza #CC-4136), 10% FCS and 1% MEM non-essential amino acids solution (ThermoFisher ...
-
bioRxiv - Developmental Biology 2022Quote: ... 400,000 H9 cells for each condition were electroporated with 1 μg plasmid via a human stem cell nucleofector™ kit (VPH-5012) by Lonza AMAXA Nucleofector 2B.
-
bioRxiv - Bioengineering 2022Quote: ... Deep Blue was prepared at a ratio of 1:10 with colourless DMEM (without pyruvate, with 4.5 g/L glucose (Lonza, Basel, Switzerland)) and was added to each existing well and incubated at 37 °C for 3 h ...
-
bioRxiv - Microbiology 2022Quote: ... NuLi-1 cells routinely tested negative for mycoplasma infection using MycoAlert Mycoplasma Detection Kit (LT07-418, Lonza Group AG, Basel, Switzerland) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... 0.4 µg/ml hydrocortisone (Upjohn 100mg SERB), 0.5 µg/ml insulin (Novo Nordisk, Novorapid Flexpen) and 1× penicillin/streptomycin (LONZA, Verviers, Belgium). The flasks were incubated at 37°C with 5% CO2 in a humidified incubator ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were co-incubated with virus and then supplemented with overlay medium that contains 1% SeaPlaque agarose (Lonza Bioscience, Basel, Switzerland). After 2 days of incubation ...
-
bioRxiv - Genomics 2023Quote: ... ATCC #CRM-CRL-1420) and PANC-1 cells (CVCL_0480, ATCC #CRM-CRL-1469) were cultured in D10 media: DMEM (Lonza #12-614Q) supplemented with 10% FBS (GELifeSciences #SH30071.03) ...
-
bioRxiv - Immunology 2023Quote: ... Md) and cultured overnight at 37C culture at 378C with 5% CO2 in serum free HL-1 media (Lonza, Walkersville, Md) supplemented with Pen-Strep and 8 mmol/L Glutamax (Gibco ...
-
bioRxiv - Genetics 2023Quote: ... The pellet was washed with 10 ml of 1 x PBS and resuspended in 20 µl of nucleofection SF buffer (Lonza Biosciences), in which 600 ng of the DsRed2-N1 plasmid was added to the suspension ...
-
bioRxiv - Cell Biology 2023Quote: ... brucei 13-90 cells were electroporated with 10 µg of linearised plasmid DNA using the Amaxa Basic Parasite Nucleofector Kit 1 and Nucleofector II device (program X-001) (Lonza, Switzerland).