Labshake search
Citations for Lonza :
1701 - 1750 of 1833 citations for ssc mir 376a 5p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... These plasmids were transfected into NHDFs and 7SPs by electroporation using the Amaxa nucleofector kit and nucleofector 2b (Lonza, Walkersvill, MD, USA). Two days later ...
-
bioRxiv - Cancer Biology 2021Quote: ... AsPC-1 and CAPAN-1 pellets were suspended in Lonza transfection reagent (SE Cell Line 4D-Nucleofector™ X Kit L, Lonza, Germany) when the Mirus transfection reagent was finished ...
-
bioRxiv - Cell Biology 2021Quote: ... 500μg of gRNA and 500μg of donor plasmids were electroporated in 1×106 mESC using P3 Primary Cell 96-well Nucleofector™ Kit (Lonza, PBP3-22500) according to manufacturer’s instruction ...
-
bioRxiv - Genomics 2022Quote: ... 8 million cells were transfected with 20ug of plasmid DNA in one 100- uL cuvette using the Amaxa® Cell Line Nucleofector® Kit V (Lonza), program X-001 ...
-
bioRxiv - Genomics 2022Quote: ... 5 million cells were transfected with 10ug of plasmid DNA in one 100- uL cuvette using the Amaxa® Cell Line Nucleofector® Kit T (Lonza), program X-001 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Electroporation of 5×106 HL-60 cells was performed with AIO-GFP HAX1 LCRC1 and AIO-GFP HAX1 LCRC2 using CLB-Transfection™ Kit (Lonza, Austria) and CLB-Transfection™ System (Lonza ...
-
bioRxiv - Microbiology 2022Quote: ... 1.2E6 BHK21 cells were nucleofected with 2 µg of Spike plasmid using an Amaxa Nucleofector II with cell line kit L (Lonza #VCA-1005) and program A-031 ...
-
bioRxiv - Biophysics 2022Quote: ... 106 U2OS cells were transfected with 1 μg of px330 plasmid and 1 μg of the HDR donor plasmid using the Nucleofector 2b device and cell line nucleofector kit V (Lonza, VCA-1003) per manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... 1uM siRNA was electroporated into cells using the Amaxa Nucleofector II device and Cell Line Nucleofector Kit V (Lonza Bioscience, VCA-1003). B16-F10 cells were electroporated with program P-020 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Point mutations were introduced into CJ7 WT using CRISPR RNP transfected into cells with the Amaxa mouse ES kit (Lonza VPH-1001). 1×106 cells were transfected with the RNP containing two separate guide RNAs a single stranded donor oligo and a linearized puromycin resistance gene ...
-
bioRxiv - Immunology 2020Quote: ... 106 cells per condition were nucleofected with 4 µg of DNA using the Amaxa Nucleofector II (Lonza, Kit R; program R-024). Nucleofected cells were allowed to recover for 24-48 hours before sorting for GFP positivity and lack of CD56 expression.
-
bioRxiv - Microbiology 2021Quote: ... the Sleeping Beauty transposase system [37] was adapted to electroporate Jurkat cells using the Lonza SE Cell Line kit (Lonza, V4SC-1960). The pSBbi-RP plasmid was a gift from Eric Kowarz (Addgene plasmid #60513 ...
-
bioRxiv - Immunology 2019Quote: ... conjugated to FITC or GFP siRNA (300 nM) conjugated to FITC two days prior to adoptive T cell therapy using the Mouse T cell Nucleofector™ Kit (Lonza Bioscience) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2019Quote: ... as a control two days prior to adoptive T cell therapy using the P3 Primary Cell 4D-Nucleofector X™ Kit (Lonza Bioscience) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2019Quote: ... 2×105 cells were co-transfected with 2ug of the Cas9/sgRNA vector PxHF1* and 4 ul of ssODN HDR template (20 uM) using a Lonza X-Unit Nucleofector with P3 buffer kit (Lonza #V4XP-3032). Four days following transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... and the GFP-K17ΔNLS (Hobbs et al., 2015) were nucleofected into HeLa cells using SE Cell Line 4D X nucleofector Kit S (Lonza #V4XC-1032) with setting DS-138 ...
-
bioRxiv - Neuroscience 2021Quote: ... Single-cell suspension of hiPSCs was nucleofected with 5 μg of the generated SpCas9-sgRNA plasmid using the P3 Primary Cell 4D-Nucleofector Kit (Lonza, #V4XP-3024) in combination with the 4D Nucleofector Unit X (Lonza ...
-
bioRxiv - Neuroscience 2020Quote: ... 500 µl of cell media was collected and the presence of adenylate kinase was measured with the ToxiLightTM cytotoxicity assay kit (Lonza, Basel, Switzerland) to check the integrity of the cell membrane ...
-
bioRxiv - Immunology 2020Quote: ... Transfection of primary T cells with Cas9 RNP complexes and TCRβα HDR templates was performed 3-4 days following activation using the 4D-Nucleofector and a 20 uL format P3 Primary Cell kit (Lonza, V4XP-3032). Briefly ...
-
bioRxiv - Microbiology 2019Quote: ... Fast-growing clonal cell lines confluent after three weeks of growth were expanded and confirmed to be mycoplasma-negative using the Myco-Alert PLUS kit (Lonza, Basel, Switzerland) prior to freezing for long-term storage in liquid nitrogen ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... plasmids pSpCas9n(BB)-ZEB2-Guide-A &-B (0.5 µg of each plasmid) were electroporated into 1×106 H9 cells using the Human Stem Cell Nucleofector Kit 1 (Lonza, VPH-5012). Following electroporation ...
-
bioRxiv - Molecular Biology 2020Quote: pSBbi-Pur-ABCC1 or empty vector were cotransfected with SB100X using the same Amaxa Nucleofector II and kit V (Lonza Group AG). Stably expressing cells were selected for using 10ug/mL puromycin (Gibco) ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 µg of sgRNA and 5 µg of ssDNA donor template (Table S1) using Human Stem Cell NucleofectorTM kit 1 (Lonza, VVPH-5012) according to the manufactures protocol and cells replated ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were transfected with pcDNA3.1 empty vector or pcDNA3.1 containing the human coding sequence of the VGLL2-NCOA2 fusion using the AMAXA cell line Nucleofection kit V (Lonza #VCA-1003;) and were selected in growth media containing 1μg/ml concentration of G418 (ThermoFisher #10131035) ...
-
bioRxiv - Immunology 2021Quote: ... gRNA_pX335 plasmids were transfected into EL4 cells by nucleofection using an Amaxa nucleofector and the Cell Line Nucleofector Kit L (Lonza, Basel, Switzerland) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... 2 million L1.2 cells were transfected with 2 µg of plasmid using the SG Cell Line transfection kit and a 4D-Nucleofector X (both from Lonza, Walkersville, MD) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... 1 × 106 BLaER1 cells were transfected with 2 μg plasmid DNA using the Human B Cell Nucleofector Kit and Nucleofector I device (program U-15; both Lonza, Basel, Schweiz). On day 2 post transfection ...
-
bioRxiv - Genomics 2021Quote: ... transfection of primary T cells with Cas9 RNP complexes and GSH1/GSH2-mRuby HDR templates was performed using the 4D-Nucleofector and a 20 uL format P3 Primary Cell kit (Lonza, V4XP-3032). Briefly ...
-
bioRxiv - Neuroscience 2020Quote: ... dissociated ganglia were pelleted at 100 x g for 5 min and resuspended in 100 µl ‘Nucleofector solution’ (Rat Neuron Nucleofector kit; Lonza, Alpharetta, GA). 4-6 μg of plasmid was electroporated using the AMAXA Nucleofector device (Neurons Rat DRG ...
-
bioRxiv - Neuroscience 2020Quote: ... Single iPSCs were then nucleofected with the pX459v2 plasmid coding for the Cas9 protein and the sgRNA using P3 primary Cell 4D nucleofector kit (Lonza, V4XP-302). After nucleofection cells were plated on a 6-well plate in E8 flex medium supplemented with RevitaCell ...
-
bioRxiv - Developmental Biology 2022Quote: ... D-001206-14-05 5 nmol) and nucleofected into OPCs using the Basic Nucleofector Kit for Primary Mammalian Glial Cells (Lonza, VPI-1006) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cells were co-transfected with 1 ug of firefly Luciferase vector and 0.1 ug Renilla luciferase vector by nucleofection with Lonza Cell Line Nucleofector® Kit V (Lonza, #VVCA-1003) and the T-020 program in the Amaxa Nucleofector II device ...
-
bioRxiv - Biochemistry 2022Quote: Normal bronchial epithelial cells (BEAS-2B / ATCC-CRL-9609) were cultured in collagen coated flasks using the bronchial epithelial growth medium supplemented with Lonza Bullet Kit (BEGM, Lonza CC-3170), as described by ATCC culture instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... The plasmids were co-transfected into H9 hESC cells using the Amaxa 4D nucleofector (#AAF-1003B and #AAF-1003X) and the P3 Primary Cell 4D-Nucleofector X kit (Lonza, #V4XP-3024).
-
bioRxiv - Molecular Biology 2022Quote: ... using nucleofection with the Amaxa 4D-Nucleofector X-Unit and the P3 Primary Cell 4D-Nucleofector X Kit (Lonza, V4XP-3024 KT). 2×106 cells were harvested using accutase (Sigma Aldrich ...
-
bioRxiv - Microbiology 2022Quote: ... pre-coated cell culture 6-well plate with EBM-2 endothelial media supplemented with 10% FBS and a growth factor bullet kit (Lonza, Walkersville, USA) 3 mL/well ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell lines were authenticated by STR testing upon receipt and were routinely tested and verified as mycoplasma negative using the MycoAlert kit (Lonza, Cambridge, MA). Human recombinant TNF was purchased from BioLegend Inc (San Diego ...
-
bioRxiv - Synthetic Biology 2022Quote: ... human aortic endothelial cells (CD31+) from were maintained in EGM™-2 Endothelial Cell Growth Medium-2 Bullet Kit™ (Cat # CC-3162; Lonza) and EGM™ −2 MV Microvascular Endothelial Cell Growth Medium-2 Bullet KitTM (Cat #CC-3202 ...
-
bioRxiv - Cancer Biology 2024Quote: ... CRISPR-CAS9 knockout in SU-DIPGXIII cells was performed using the Amaxa P3 Primary Cell 4D-Nucleofector X Kit L (Lonza, V4XP-3012). First ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and the cell pellet was resuspended in Keratinocyte Growth Medium-2 Bullet Kit (KGM2 medium) consisting of KGM-2 Basal Medium and KGM-2 SingleQuots Supplements (Lonza, Basel, Switzerland), and then seeded onto Petri dishes coated with collagen IV ...
-
bioRxiv - Synthetic Biology 2024Quote: Electroporation was done 7 days after stimulation by DynaBeads using a P3 Primary Cell 4D-Nucleofector™ X Kit (Lonza #V4XP-3012). 750 ng of HDR template was mixed with 50 pmol of RNP and incubated at room temperature for 10 minutes ...
-
bioRxiv - Genomics 2024Quote: ... and electroporated with 6 μg of gRNA-Cas9 expression vector and 3 μg of SNRPN targeting vector using the P3 Primary Cell 4D-Nucleofector Kit (Lonza, V4XP-3032). Transfected cells were plated into a 10 cm dish coated with Matrigel (Corning ...
-
bioRxiv - Genomics 2024Quote: ... were complexed for 20 minutes at room temperature and were nucleofected into 5E5 PEmax parental cells using the SE Cell Line 4D-Nucleofector X Kit (Lonza V4XC-1032) and program FF-120 ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cells were resuspended in 20 µl nucleofection buffer (16.4 µl Nucleofector® Solution + 3.6 µl Supplement) provided in P3 Primary Cell 4D-Nucleofector™ X Kit S (Lonza, V4XP-3032). After the addition of 3 µl RNP and 0.5 µl of Alt-R Cas9 Electroporation Enhancer (IDT ...
-
bioRxiv - Genetics 2023Quote: ... The media was removed from the cell pellet and cells were resuspended according to the protocol provided for the P3 Primary Cell 4D-Nucleofector Kit (Lonza, V4XP-3024). Briefly ...
-
bioRxiv - Genomics 2023Quote: ... 200,000 cells were nucleofected with 50 fmol transposon and 50 fmol transposase (Super piggyBac Transposase - SystemBio PB210PA-1) or with 300 ng pmaxGFP using the P2 Primary Cell 4D Nucleofector kit (Lonza V4SP-2096) and the Lonza 4D- Nucleofector with the DS-150 program ...
-
bioRxiv - Immunology 2022Quote: LPS concentration in serum was determined using a chromogenic assay based on a Limulus amebocyte extract (LAL kit-terminal QCL1000) (LONZA, Basel, Switzerland). Samples were collected at the time of euthanasia via cardiac puncture to try to minimize as much as possible the chance of contamination ...
-
bioRxiv - Neuroscience 2023Quote: ... 8 x 105 hiPSCs in single-cell suspension were nucleofected with 5 μg SpCas9-sgRNA plasmid using the P3 Primary Cell 4D-Nucleofector Kit (Lonza, #V4XP-3024) in combination with the 4D Nucleofector Unit X (Lonza ...
-
bioRxiv - Developmental Biology 2023Quote: ... ePB master vector and helper (Plasmid AW-27) were nucleofected into the established SOX2::mCitrine cell line using the P3 Primary Cell 4D-Nucleofector X Kit (Lonza; V4Xp-3012). G-418 (40ng/mL ...
-
bioRxiv - Developmental Biology 2023Quote: ... and guide RNA (Plasmid AW-P45; GTGCCCGGCACGGCCATTAA) were nucleofected in hPSCs using the P3 Primary Cell 4D-Nucleofector X Kit (Lonza; V4Xp-3012), and positive transformants were selected with blasticidin (10μg/ml ...