Labshake search
Citations for Lonza :
1701 - 1750 of 2766 citations for Hydrogen Peroxide Fluorescent Detection Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... HXGPRT amplicon (2-5 µg) into 1x106 RH TIR1-3FLAG tachyzoites in P3 buffer using a 4D-nucleofector (Lonza) with pulse code FI-158 ...
-
bioRxiv - Cell Biology 2022Quote: Human umbilical vein endothelial cells (HUVEC) were cultured between passage 3 and 6 in EGM-2 complete medium (Lonza)3,52–55 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The resulting vector was used to generate a D.mel-2 stable cell line adapted to grow in suspension in serum-free Insect-Xpress medium (Lonza). In brief ...
-
bioRxiv - Bioengineering 2022Quote: ... embryos were anesthetized by 30 mg/L tricaine-S (Western Chemical) and mounted in 2% low melting agarose (LONZA) for dorsal or lateral view in 35 mm Petri dishes with a glass bottom ...
-
bioRxiv - Immunology 2022Quote: ... were coated overnight at 4°C with 25μL of SEC fractions 1 to 5 diluted 1:2 with PBS (Cat. No. LZBE17-512F, Lonza). Wells were washed with 0.05% Tween-20 (Cat ...
-
bioRxiv - Microbiology 2022Quote: ... and neonatal dermal microvascular endothelial cells (hDMVEC) were maintained as monolayer cultures in EBM-2 medium (Lonza, Walkersville, USA) supplemented with 5% fetal bovine serum ...
-
bioRxiv - Immunology 2022Quote: ... 2.4 μl CRISPR guide RNA (gRNA; key resource table) (100 μM) and 2 μl Cas9-NLS (80 μM) (Lonza) were mixed and incubated for 40 minutes at 37 °C ...
-
bioRxiv - Cancer Biology 2024Quote: ... Human Umbilical Vein Endothelial Cells (HUVECs) were cultured in complete EGM-2 (cat# CC-3162, Lonza, Allendale, NJ, USA) and were not used beyond passage five for any experiments.
-
bioRxiv - Biophysics 2024Quote: ... The culture was diluted to approximately OD600 0.003 and spread onto a pad with 2% agarose (SeaPlaque GTG Agarose, Lonza) in RDM + glucose on a microscopy slide ...
-
bioRxiv - Cancer Biology 2024Quote: ... and (iv) the NDF-2 and NDF-3 cell lines (human neonatal dermal fibroblast cell lines, #CC-2509; Lonza Bioscience ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2 μg of assembled pGL3 plasmid were electroporated into 2.5×105 AIC-H9-hESCs 35 by 4D-Nucleofector (Lonza) using P3 Primary Cell 4D-Nucleofector X kit (Lonza) ...
-
bioRxiv - Cancer Biology 2023Quote: SK-N-BE (2) (ATCC: no. CRL-2271) cells were cultured in Dulbecco’s Modified Eagle Medium (Lonza, Cat# BW12614F), supplemented with heat-inactivated FBS (Hyclone ...
-
bioRxiv - Genetics 2023Quote: ... IMR90 fetal lung fibroblasts at passage 7 were cultured in FGM-2 lung fibroblast basal media (Lonza, #CC-3131) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2023Quote: All cell lines were authenticated by Brca1/2-specific PCR-based genotyping (mouse)7,8 and they were regularly tested for mycoplasma contamination (Mycoalert, Lonza).
-
bioRxiv - Bioengineering 2023Quote: ... cAP-0001GFP) were cultured in 0.2% gelatin-coated T75 tissue culture flasks with EGM-2 medium (Lonza, CC-3162). The medium was changed every other day ...
-
bioRxiv - Biochemistry 2024Quote: ... the media supernatant was removed and we washed the cells with 2 ml of prewarmed 1xDPBS (Lonza, 17-512F). The PBS was then removed and cells were then incubated at 37°C in 250 μL of trypsin (Corning ...
-
bioRxiv - Neuroscience 2024Quote: ... dissociated neurons were electroporated with cDNA (2 µg) or siRNA (Table S2) using an Amaxa nucleofector (program-005, Lonza) and mouse neuron nucleofectorTM kit (VPG-1001 ...
-
bioRxiv - Cancer Biology 2021Quote: ... using buffer R (Amaxa Nucleofector Kit R VCA-1003; Lonza) and program R-001 ...
-
bioRxiv - Cell Biology 2020Quote: ... siRNA delivery was performed using either Nucleofector Kit V (Lonza) or Neon transfection system (Life Technologies ...
-
bioRxiv - Neuroscience 2020Quote: The adenylate kinase assay (ToxiLightTM bioassay kit LT07-217 Lonza) to assess toxicity was performed following the instructions of the manufacturer ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4 days after nucleofection with the AMAXA Nucleofector Kit (Lonza), we applied puromycin selection until we observed the appearance of green colonies ...
-
bioRxiv - Cell Biology 2019Quote: ... MCF 10A cells were cultured in the MEGM kit (Lonza) at 37°C with 5% CO2 ...
-
bioRxiv - Bioengineering 2020Quote: ... with a 20 μl P3 solution kit (Lonza, #V4XP-3032) with 600k PGP1 WT cells in each 20 μl reaction well as per manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... Cells were transfected using the Amaxa HUVEC Nucleofector kit (Lonza) according to the manufacturer’s protocol (2-5 µg plasmid DNA ...
-
bioRxiv - Bioengineering 2020Quote: ... supplemented with EGM Endothelial Cell Growth Medium SingleQuots Kit (Lonza) and used at passage 3-6 ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were suspended in EGM Media with Bullet Kit (Lonza) supplemented with 1μM Chiron ...
-
bioRxiv - Neuroscience 2021Quote: ... using an Amaxa Mouse Neuron Nucleofector kit (Lonza, VPG-1001) as described previously (Wuttke et al. ...
-
bioRxiv - Cancer Biology 2021Quote: ... supplemented with recommended growth supplement kit (EGM-2MV BulletKit, Lonza). Mouse mammary carcinoma cell line 4T1-luc-red (generously given by the Cross laboratory at University of Virginia ...
-
bioRxiv - Cell Biology 2021Quote: ... using the Amaxa human keratinocyte Nucleofector kit (Lonza, #VPD-1002) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... fibroblasts were transfected by nucleofection (Kit V4XP-2024, Lonza, Switzerland) with the gene drive plasmid ...
-
bioRxiv - Microbiology 2019Quote: ... and using the Amaxa human CD34+ cells Nucleofection Kit (Lonza), following the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2021Quote: ... from the P3 Primary Cell 96-well Nuclofector kit (Lonza). 3 µL of the assembled Cas9 RNPs were added to the cells ...
-
bioRxiv - Immunology 2022Quote: ... Cells were nucleofected using Cell Line Nucleofector Kit V (Lonza) for cell lines and P3 Primary Cell 4D-Nucleofector X Kit L (Lonza ...
-
bioRxiv - Bioengineering 2021Quote: ... tested for mycoplasma contamination using the MycoAlert Microplasma Kit (Lonza), and cultured with 0.2-micron filtered DMEM media (Thermo Fisher ...
-
bioRxiv - Developmental Biology 2019Quote: ... cells were kept in HCM medium (HCM Bullet Kit, Lonza) supplemented with “singlequots” supplied with the kit (except for the EGF ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... using the MycoAlert PLUS assay kit from Lonza (Basel, Switzerland), and were authenticated by short tandem repeat profiling.
-
bioRxiv - Neuroscience 2021Quote: ... 4D-Nucleofector™ unit X Kit (program CA-137; Lonza) was used according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... Cultures were tested for mycoplasma using a MycoAlert Kit (Lonza), and for bacteria ...
-
bioRxiv - Immunology 2024Quote: ... were nucleofected using P3 Primary cell 4D-nucleofection kit (Lonza) and DN100 pulse on 4D nucleofector X unit (Lonza) ...
-
bioRxiv - Cell Biology 2024Quote: ... in combination with the P3 Primary Cell Buffer Kit (Lonza). Per sample ...
-
bioRxiv - Genetics 2024Quote: ... and SF Cell Line 4D X Kit (Lonza, #V4XC-2024) were employed ...
-
bioRxiv - Cell Biology 2024Quote: ... and the Cell line Nucleofector Kit T (Lonza, VCA-1002) were used for the plasmids cells transfections (1-5 µg) ...
-
bioRxiv - Bioengineering 2023Quote: ... and Amaxa Human CD34+ Cell Nucleofector kit (Lonza, Basel, Switzerland) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... Nucleofection was performed using the Amaxa MEF2 Nucleofector Kit (Lonza) following the manufacturer’s suggested protocol ...
-
Chromatin priming elements direct tissue-specific gene activity prior to hematopoietic specificationbioRxiv - Genomics 2023Quote: ... with the P3 Primary Cell X kit (Lonza, V4XP-3024). ES cells clones were picked and screened for successful homologus CRISPR by PCR using primers designed outside of the CRISPR guide region (AAGGCTGTCTAGCACTCGTT ...
-
bioRxiv - Neuroscience 2023Quote: ... using the P3 Primary Cell nucleofector kit (Lonza, V4XP-3012). 8×105 cells were resuspended in 100µl P3 solution ...
-
bioRxiv - Biochemistry 2023Quote: ... Using Amaxa SF Cell Line 4D-Nucleofector X Kit (Lonza), WT HEK293T cells were transfected with a transposase-encoding plasmid (pSB100X) ...
-
bioRxiv - Bioengineering 2023Quote: ... SE and P3 Cell Line 4D-Nucleofector X Kit (Lonza) was used as the nucleofection agent following the manufacturer’s protocol ...
-
Cancer-associated fibroblasts produce matrix-bound vesicles that influence endothelial cell functionbioRxiv - Cancer Biology 2023Quote: Transient knockdown was performed using the Amaxa kit R (Lonza) and Nucleofector device (program T-20 ...
-
bioRxiv - Cell Biology 2023Quote: Nucleofection was performed using the Amaxa MEF2 Nucleofector Kit (Lonza) following the manufecturer’s suggested protocol ...