Labshake search
Citations for Lonza :
1651 - 1700 of 4136 citations for Rat Neural Stem Cell Media since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... Human embryonic kidney 293 cells (HEK 293FT) obtained from Lonza were cultured on flasks coated with 20 μg/ml collagen type I ...
-
bioRxiv - Molecular Biology 2022Quote: K562 cells were cultured in RPMI medium (Lonza, Basel, Switzerland). HEK293T ...
-
bioRxiv - Biophysics 2022Quote: ... The cells were then transitioned to Insect Xpress medium (Lonza) for large-scale expression in 2-liter Erlenmeyer flasks ...
-
bioRxiv - Biochemistry 2022Quote: ... Cell cultures grown in Insect-Xpress medium (Lonza, 12-730Q) were infected with high-titer baculovirus at a density of 2.0 × 106 cells ml−1 and incubated for 72 h at 27 °C ...
-
bioRxiv - Biophysics 2022Quote: ... at 80,000 cells/well in 200 μl RPMI 1640 (Lonza) containing 10mM HEPES (Roth ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were transfected using the Amaxa 4D nucleofection system (Lonza) in 16-well cuvette strips ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were transfected using the Amaxa 4D nucleofection system (Lonza) and the DN100 programme ...
-
bioRxiv - Developmental Biology 2022Quote: ... 106 cells were then resuspended in 100ml P3 buffer (Lonza) and mixed with the prepared Cas9-RNPs and 5ml EP enhancer (IDT) ...
-
bioRxiv - Cell Biology 2022Quote: ... human umbilical vein endothelial cells (HUVEC) were acquired from Lonza and cultured in EGM-2 medium (Lonza ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were grown in prestimulation medium made of Xvivo (Lonza) supplemented with penicillin/streptomycin (respectively 100U/mL and 100µg/mL - Gibco ...
-
bioRxiv - Developmental Biology 2022Quote: ... The cell pellet was re-suspended in Ultraculture Medium (Lonza), supplemented with 5% v/v fetal bovine serum (FBS ...
-
bioRxiv - Genetics 2022Quote: ... Delivery into A20 cells was performed via 4D-Nucleofector (Lonza) with buffer SF and pulse code FF113.
-
bioRxiv - Immunology 2022Quote: ... Cells were cultured in DMEM (#12-614F, Lonza, Walkersville, MD) supplemented with 10% bovine calf serum (BCS ...
-
bioRxiv - Microbiology 2022Quote: ... The cells were nucleofected using 4D Nucleofector LV Unit (Lonza) and collected in 5 mL of complete growth medium ...
-
bioRxiv - Neuroscience 2022Quote: ... the cells were cultivated in DMEM (Lonza, cat# BE12-614Q), supplemented with 10% v/v inactivated fetal bovine serum (Invitrogen) ...
-
bioRxiv - Immunology 2022Quote: ... red blood cells were removed using ACK lysis buffer (Lonza), and cells were then cultured in 10 cm coated dishes for 7-8 days in complete cell culture media (RPMI 10% FBS ...
-
bioRxiv - Bioengineering 2022Quote: ... and human liver endothelial cells (HLECs, Lonza, catalogue no. HLECP2) were routinely cultured in T75 flasks (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... Cells were maintained in MesoEndo growth medium (Lonza, Basel, Switzerland) in 5% CO2 incubator ...
-
bioRxiv - Cell Biology 2023Quote: ... All cells were determined to be negative for mycoplasma (Lonza).
-
bioRxiv - Immunology 2023Quote: ... red blood cells were lysed with ACK Lysis Buffer (Lonza), incubated for 2 minutes at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... normal human bronchial epithelial cells (NHBEs, Cat# CC-2540, Lonza) were used to generate AOs ...
-
Red Algae-Derived Mineral Intervention to Counter Pro-inflammatory Activity in Human Colon OrganoidsbioRxiv - Molecular Biology 2022Quote: ... calcium-free culture medium optimized for epithelial cell growth (Lonza). The final serum concentration in the L-WRN – KGM Gold culture medium was 2.5% and the calcium concentration was 0.25 mM ...
-
bioRxiv - Cell Biology 2023Quote: ... Human coronary artery endothelial cells (HCAECs) were purchased from Lonza Clonetics (Walkersville ...
-
bioRxiv - Cancer Biology 2022Quote: ... All cell lines were routinely tested for mycoplasma contamination (Lonza MycoAlertTM PLUS Mycoplasma Detection Kit ...
-
bioRxiv - Microbiology 2022Quote: ... normal human bronchial epithelial cells (NHBEs, Cat# CC-2540, Lonza) were used to generate AOs ...
-
bioRxiv - Cell Biology 2023Quote: ... Isolated B-cells were kept on ice in DMEM (Lonza) supplemented with 0.6% BSA (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2023Quote: ... Using Amaxa SF Cell Line 4D-Nucleofector X Kit (Lonza), WT HEK293T cells were transfected with a transposase-encoding plasmid (pSB100X) ...
-
bioRxiv - Biophysics 2023Quote: ... Cell lines were regularly checked for mycoplasma contamination (MycoAlert, Lonza).
-
bioRxiv - Bioengineering 2023Quote: Human umbilical vein endothelial cells (HUVEC) were purchased from Lonza and cultured in endothelial media (VascuLife ...
-
bioRxiv - Biophysics 2023Quote: ... T cells were cultured in X-VIVO 15 medium (Lonza) with 10% v/v FBS (Corning) ...
-
bioRxiv - Genomics 2023Quote: All cell lines used were routinely tested for Mycoplasma (Lonza Mycoalert and EZ-PCR Mycoplasma Detection Kit ...
-
bioRxiv - Immunology 2023Quote: ... Red blood cells were lysed with ACK lysis buffer (Lonza) and washed in PBS and used for flow cytometry analysis.
-
bioRxiv - Immunology 2023Quote: ... Red blood cells were lysed with ACK lysis buffer (Lonza) and washed in PBS and used for cell sorting or flow cytometry analysis.
-
bioRxiv - Neuroscience 2023Quote: ... and cells were immediately nucleofected with Amaxa 4D-Nucleofector (Lonza), using program CB-150 ...
-
bioRxiv - Physiology 2023Quote: ... Cryopreserved human aortic smooth muscle cells were obtained from Lonza Pharma and Biotech (Catalog # ...
-
bioRxiv - Physiology 2023Quote: ... HEK293T cells and Human subcutaneous preadipocytes (Lonza Catalog #: PT-5020) were used for all cell culture-related experiments ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... hTERT HME1 cells were cultured in MEGM BulletKit medium (Lonza) and supplemented with 5% FBS for dose-response assays.
-
Chromatin priming elements direct tissue-specific gene activity prior to hematopoietic specificationbioRxiv - Genomics 2023Quote: ... with the P3 Primary Cell X kit (Lonza, V4XP-3024). ES cells clones were picked and screened for successful homologus CRISPR by PCR using primers designed outside of the CRISPR guide region (AAGGCTGTCTAGCACTCGTT ...
-
bioRxiv - Bioengineering 2023Quote: ... CiGEnC were cultured in Endothelial Cell Basal Medium-2 (Lonza) containing Microvascular Endothelial Cell Growth Medium-2 SingleQuots Kit (EGM-2 MV ...
-
bioRxiv - Neuroscience 2023Quote: ... using the P3 Primary Cell nucleofector kit (Lonza, V4XP-3012). 8×105 cells were resuspended in 100µl P3 solution ...
-
bioRxiv - Immunology 2023Quote: ... supplemented with EGMTM Endothelial Cell Growth Medium SingleQuots (Lonza, Swiss). Passages 4 to 8 were used for experiments.
-
bioRxiv - Genomics 2023Quote: ... Primary tumour cells were treated with ACK lysis buffer (Lonza) followed by resuspension in 1% BSA/PBS and processed using the Mouse and Dead Cell depletion kits according to the manufacturer directions (Mylteni).
-
bioRxiv - Cell Biology 2023Quote: ... All cells were routinely checked for mycoplasma contamination (MycoAlert, Lonza).
-
bioRxiv - Immunology 2023Quote: A healthy human bronchial smooth muscle cell line (BSMC, Lonza) was cultured in Smooth Muscle Growth Medium (Lonza ...
-
bioRxiv - Bioengineering 2022Quote: ... CHO-mAb cell line was maintained in PowerCHO2CD medium (Lonza) supplemented with glutamine synthetase expression medium (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2023Quote: ... SE and P3 Cell Line 4D-Nucleofector X Kit (Lonza) was used as the nucleofection agent following the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2023Quote: ... Primary human umbilical vein endothelial cells (HUVEC; Lonza, Basel, Switzerland) were cultured in Endothelial Cell Growth Medium-2 BulletKit (EGM-2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The cells were nucleofected using a 4D-nucleofector device (Lonza) in 20-µL Nucleocuvette strips (Lonza) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human umbilical vein endothelial cells (HUVECs, Lonza, Allendale, NJ, USA) were cultured in EGM-2 (Lonza ...
-
bioRxiv - Cell Biology 2023Quote: ... and A549 cells were grown in DMEM (Lonza, BE12-604F) supplemented with 10% fetal bovine serum (Sigma ...