Labshake search
Citations for Lonza :
1651 - 1700 of 1765 citations for Rat Isotyping kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: LPS concentration in serum was determined using a chromogenic assay based on a Limulus amebocyte extract (LAL kit-terminal QCL1000) (LONZA, Basel, Switzerland). Samples were collected at the time of euthanasia via cardiac puncture to try to minimize as much as possible the chance of contamination ...
-
bioRxiv - Neuroscience 2023Quote: ... 8 x 105 hiPSCs in single-cell suspension were nucleofected with 5 μg SpCas9-sgRNA plasmid using the P3 Primary Cell 4D-Nucleofector Kit (Lonza, #V4XP-3024) in combination with the 4D Nucleofector Unit X (Lonza ...
-
bioRxiv - Developmental Biology 2023Quote: ... ePB master vector and helper (Plasmid AW-27) were nucleofected into the established SOX2::mCitrine cell line using the P3 Primary Cell 4D-Nucleofector X Kit (Lonza; V4Xp-3012). G-418 (40ng/mL ...
-
bioRxiv - Developmental Biology 2023Quote: ... and guide RNA (Plasmid AW-P45; GTGCCCGGCACGGCCATTAA) were nucleofected in hPSCs using the P3 Primary Cell 4D-Nucleofector X Kit (Lonza; V4Xp-3012), and positive transformants were selected with blasticidin (10μg/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... The cells used in this study were negatively tested for mycoplasma contamination using MycoAlert™ Mycoplasma Detection Kit (LT07-118, Lonza, Switzerland).
-
bioRxiv - Neuroscience 2023Quote: ... All cell lines used in this study were tested mycoplasma free by first culturing the cells for 3-5 days in antibiotic-free media and then subjected to a mycoplasma tested using MycoAlert™ PLUS Mycoplasma Detection Kit (Lonza, UK).
-
bioRxiv - Cell Biology 2023Quote: ... All cells were cultured at 37 °C and 5% CO2 in a humidified incubator and regularly tested for mycoplasma using the MycoAlert mycoplasma detection kit (Lonza, LT07-418).
-
bioRxiv - Cell Biology 2023Quote: ... All cell lines were routinely confirmed to be negative for mycoplasma by testing with a MycoAlert Mycoplasma Detection Kit (Lonza # LT07-701).
-
bioRxiv - Bioengineering 2023Quote: ... were cultured in Endothelial Cell Basal Medium (EBM) supplemented with the Endothelial Growth Media kit (EGM-2) (CC-3162, Lonza, Basel, Switzerland). All cells were maintained at 37°C and 5% CO2 and used between passage number 3-7 ...
-
bioRxiv - Immunology 2023Quote: ... Purified templates together with 2 µg of LentiGuide-Gbp-Chr3-sg3+sg4 were electroporated into RAW-Cas9 cells using Lonza SF cell line X kit (Lonza, V4XC-2012) on a Lonza 4D-Nucleofector unit (Lonza) ...
-
bioRxiv - Cell Biology 2023Quote: ... 100,000 MCF10a cells was nucleofected with program DS-138 using an Amaxa 4D-Nucleofector X using the SE Cell Line 4D X Kit S 32 RCT (Lonza V4XC-1032). Reactions were split between two 24-well plates and grown in complete media three days ...
-
bioRxiv - Genomics 2023Quote: ... All cells were cultured with 5% CO2 at 37°C and verified to be free of mycoplasma using the MycoAlert Mycoplasma Detection Kit (Lonza, LT07-218). Wild type MCF7 cells were a gift from Howard Y ...
-
bioRxiv - Microbiology 2023Quote: ... with 1 uL of 20 uM Cas9-NLS (UC Berkeley Macro Lab) and RNP complexes were made with SE Cell Line 96-well Nucleofector Kit (Lonza, V4SC-1096). Complexes were incubated at room temperature for ten minutes ...
-
bioRxiv - Microbiology 2023Quote: ... Guides targeting CCNT1 were complexed with 1 uL of 20 uM Cas9-NLS (UC Berkeley Macro Lab) and RNP complexes were made with SE Cell Line 96-well Nucleofector Kit (Lonza, V4SC-1096). Complexes were incubated at room temperature for ten minutes ...
-
bioRxiv - Genomics 2023Quote: ... was mixed with 16.4 μL Nucleofector SolutionTM and 3.6 μL Supplement and incubated at room temperature for about 10 min according to the instruction of Amaxa 4D-Nucleofector X Kit TM (Lonza, #V4XP-3032). HepG2 ...
-
bioRxiv - Microbiology 2023Quote: ... cells then were electroporated using electroporation code EH-100 and using the P3 Primary Cell 96-well Nucleofector Kit (Lonza, V4SP-3096). Knockout pools were maintained for an additional nine days prior to coculturing with H80 feeder cell line with IL-2 (Final conc 20 U/mL ...
-
bioRxiv - Cancer Biology 2022Quote: ... All human cell lines were authenticated by STR analysis at the JCRB Cell Bank and tested for Mycoplasma contamination using a MycoAlert Mycoplasma Detection Kit (Lonza, Basel, Switzerland).
-
bioRxiv - Cancer Biology 2023Quote: ... All cell lines used in this study tested negative for Mycoplasma contamination via MycoAlert™ PLUS Mycoplasma Detection Kit (Lonza, Basel, Switzerland).
-
bioRxiv - Cell Biology 2023Quote: PMOs were dissolved in distilled water and transfected into RD cells using the Amaxa Cell Line Nucleofector Kit L and a Nucleofector II electroporation device (Lonza, Basel, Switzerland) with program T-030 or into cells from a DMD patient without a transfection reagent.
-
bioRxiv - Molecular Biology 2023Quote: Induced pluripotent stem cells were transfected with a total of 5 μg target Cas9/gRNA plasmids with or without 1 μg repair templates using Human Stem Cell Nucleofector Kit (LONZA, Basel, Switzerland) and Nucleofector 2b device (LONZA ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were regularly passaged 2-3 times a week and routinely tested for mycoplasma contamination using MycoAlert Plus mycoplasma Detection kit (Lonza, #LT07-710).
-
bioRxiv - Bioengineering 2023Quote: ... 100,000 cells were resuspended in 20μl P3 reagent of the P3 Primary Cell 4D-Nucleofector® X Kit S (Lonza V4XP-3032). 1 μg total plasmid was used for a single nucleofection event and nucleofected by program EH-100 ...
-
bioRxiv - Cell Biology 2023Quote: ... The linearized construct and the purified schizonts were mixed with Nucleofector solution from an Amaxa human T cell Nucleofector Kit and electroporated using the Amaxa Nucleofector II device (Lonza, Köln, Germany). Directly after transfection 50 µl RPMI-1640 complete was added to the transfection reaction followed by intravenous injection into one SWISS mouse ...
-
bioRxiv - Genomics 2023Quote: ... 200,000 cells were nucleofected with 50 fmol transposon and 50 fmol transposase (Super piggyBac Transposase - SystemBio PB210PA-1) or with 300 ng pmaxGFP using the P2 Primary Cell 4D Nucleofector kit (Lonza V4SP-2096) and the Lonza 4D- Nucleofector with the DS-150 program ...
-
bioRxiv - Microbiology 2023Quote: ... All parasite strains and host cell lines were routinely tested for mycoplasma contamination with the MycoAlert Mycoplasma Detection Kit (Lonza, Basel, Switzerland) and found to be negative.
-
bioRxiv - Genomics 2023Quote: ... Each plasmid library was transfected into K562 or A549 cells by electroporation using Lonza SF Cell Line 4D-Nucleofector X Kit (Lonza V4XC-2012) with Lonza 4D-Nucleofector ...
-
The spindle protein CKAP2 regulates microtubule dynamics and ensures faithful chromosome segregationbioRxiv - Cell Biology 2023Quote: ... and immediately transfected by Nucleofection into HT-1080 cells using the Amaxa SF Cell Line 4D-Nucleofector X kit S (Lonza, PBC2-00675) and either program FF-113 (HT1080 ...
-
bioRxiv - Genetics 2023Quote: ... The media was removed from the cell pellet and cells were resuspended according to the protocol provided for the P3 Primary Cell 4D-Nucleofector Kit (Lonza, V4XP-3024). Briefly ...
-
bioRxiv - Cell Biology 2023Quote: ... Cell lines were cultured in a humidified incubator at 37°C and 5% CO2 and regularly tested for mycoplasma using the MycoAlert mycoplasma detection kit (Lonza, LT07-418).
-
bioRxiv - Cancer Biology 2023Quote: ... All cell lines were authenticated by STR profiling (Eurofins, Val Fleuri, Luxembourg) and were tested negative for mycoplasma (MycoAlert PLUS mycoplasma detection kit, Lonza, Basel, Switzerland).
-
bioRxiv - Immunology 2023Quote: ... Constructs were transiently transfected into KRT17 null A431 cells using the SF Cell Line 4D-Nucleofector™ X Kit (Lonza #V4XC-2032) and Lonza 4D-nucleofector X unit “A431 cell” program ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were maintained at 37°C and 5% CO2 in 2D monolayer culture and confirmed as Mycoplasma negative (MycoAlert Mycoplasma Detection Kit, Lonza #LT07-701). Cells were maintained in DMEM medium (Corning #10-013-CV ...
-
bioRxiv - Cancer Biology 2024Quote: ... Mycoplasma testing was performed on all cells when they were thawed and semi-regularly thereafter using the MycoAlert PLUS Mycoplasma Detection Kit (Lonza LT07-703). Independent experiments were performed on cells treated with siRNA and/or compounds from separate passages of each cell line ...
-
bioRxiv - Cell Biology 2024Quote: ... 8 x 105 H9 hESCs in single-cell suspension were resuspended in 100 µL electroporation buffer from the Human Stem Cell Nucleofector Solution 2 kit (Lonza, VPH-5022). Alt-R Cas9 Electroporation enhancer (1.1 µM ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell lines were authenticated by short tandem repeat analysis and routinely tested for mycoplasma using the MycoAlert mycoplasma detection kit (Lonza, #LT07-710).
-
bioRxiv - Cancer Biology 2024Quote: ... after thaw for about 1 week and tested for mycoplasma regularly using the MycoAlertTM PLUS Mycoplasma Detection Kit (Lonza, CAT#: LT07-318). Cells were always used within 10 passages of authentication via STR analysis with CellCheck9 by IDEXX laboratories.
-
bioRxiv - Genetics 2024Quote: ... 3x105 Daudi cells were nucleofected with 20 picomole of sgRNA-Cas9 complex and 100 picomole of DNA donor template using program CA137 of Amaxa 4D-Nucleofector and SF cell line kit S (Lonza, V4XC-2032). The edited single-cell clones were sorted into 96-well plate by BD Aria II sorter and expanded for 4 weeks ...
-
bioRxiv - Cell Biology 2024Quote: ... was transfected into 106 U2OS cells using the Amaxa Nucleofector System with the Cell Line Nucleofector Kit V (catalog no: VCA-1003, Lonza, Cologne, Germany) utilizing program X-001 according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... and 1.2 μl of Alt-R® Cas9 Electroporation enhancer (100 μM, IDT) using P3 Primary Cell Nucleofector® 4D Kit and Nucleofector 4D system (Lonza). After electroporation ...
-
bioRxiv - Systems Biology 2024Quote: ... HiFi Cas9 Nuclease V3 protein (IDT, 1081058) were introduced into low-passage dual-reporter ESCs using the Mouse Embyronic Stem Cell Nucleofector Kit (Lonza VPH-1001). ESCs were treated with 0.025% trypsin/1% EDTA (Gibco ...
-
bioRxiv - Cancer Biology 2024Quote: ... All cell lines were authenticated and routinely tested to be mycoplasma-free using the MycoAlert Mycoplasma Detection Kit (Lonza, Cat # LT07-710) every two months ...
-
bioRxiv - Neuroscience 2024Quote: ... following a previously described protocol.43-44 Cultures underwent testing every other month using the MycoAlert Mycoplasma Detection Kit (Lonza LT07-318) and consistently tested negative for mycoplasma throughout the study.
-
bioRxiv - Cell Biology 2024Quote: ... the Ribonucleoprotein (RNP) complexes (9:1 sgRNA to Cas9 ratio) were assembled in Nucleofector Solution plus Supplement (Lonza Amaxa HMEC Nucleofector Kit) to a total volume of 100µL ...
-
bioRxiv - Cell Biology 2024Quote: ... In microscopy experiments we used the same media but without phenol red to reduce background fluorescence (Lonza CC-3153 phenol-red free basal media supplemented with growth factors and other components from the Lonza CC4136 kit). T98G cells were purchased from ATCC ...
-
bioRxiv - Cancer Biology 2021Quote: ... All cell lines used in this study tested negative for Mycoplasma contamination via MycoAlert™ PLUS Mycoplasma Detection Kit (LT07-710, Lonza, Basel, Switzerland).
-
bioRxiv - Genomics 2020Quote: ... 2*106 TX1072 mESCs were electroporated with 2µg of each guide plasmid and 30pmol of the single stranded repair oligo using the P3 Primary Cell 4D-Nucleofector X Kit (V4XP-3024) with the Amaxa 4D Nucleofector system (Lonza, program CP-106) and plated on gelatin-coated 10cm dishes ...
-
bioRxiv - Cancer Biology 2019Quote: ... PrEC cells were cultured in Prostate Epithelial Cell Basal Medium (PrEGM) supplemented with Prostate Epithelial Cell Growth Kit (Clonetics™ PrEGM™, BulletKit™, Lonza). All cell cultures were maintained at 37°C in an incubator with a controlled humidified atmosphere composed of 95% air and 5% CO2.
-
bioRxiv - Cancer Biology 2019Quote: ... Cells were tested biweekly during experiments using a mycoplasma detection kit to confirm absence of mycoplasma contamination using the Lonza MycoAlert® (Lonza #LT07-318). HCC1806 cells were grown in RPMI 1640 Medium (Life Technologies #11875093 ...
-
bioRxiv - Immunology 2019Quote: ... two PX330-GFP vectors coding different CD80 sgRNA were electroporated into wild-type Raji cells (CD80+/CD86+/PD-L1-) using Cell Line Nucleofector Kit V (LONZA, catalog VACA-1003). Electroporated cells were recovered for two days at 37 °C/5% CO2 ...
-
bioRxiv - Neuroscience 2019Quote: ... Cortical neurons from C57BL/6J and C57BL/6J Sorcs1flox/flox mice were electroporated with DNA just before plating using an AMAXA Nucleofector kit (Lonza, Cat #VPG-1001). Cortical neurons from C57BL/6J Sorcs1flox/flox mice were transfected at DIV7 using Effectene (Qiagen ...