Labshake search
Citations for Lonza :
1651 - 1700 of 2612 citations for BCA Protein Colorimetric Detection Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2020Quote: ... with a 20 μl P3 solution kit (Lonza, #V4XP-3032) with 600k PGP1 WT cells in each 20 μl reaction well as per manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... Cells were transfected using the Amaxa HUVEC Nucleofector kit (Lonza) according to the manufacturer’s protocol (2-5 µg plasmid DNA ...
-
bioRxiv - Bioengineering 2020Quote: ... supplemented with EGM Endothelial Cell Growth Medium SingleQuots Kit (Lonza) and used at passage 3-6 ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were suspended in EGM Media with Bullet Kit (Lonza) supplemented with 1μM Chiron ...
-
bioRxiv - Neuroscience 2021Quote: ... using an Amaxa Mouse Neuron Nucleofector kit (Lonza, VPG-1001) as described previously (Wuttke et al. ...
-
bioRxiv - Cancer Biology 2021Quote: ... supplemented with recommended growth supplement kit (EGM-2MV BulletKit, Lonza). Mouse mammary carcinoma cell line 4T1-luc-red (generously given by the Cross laboratory at University of Virginia ...
-
bioRxiv - Cell Biology 2021Quote: ... using the Amaxa human keratinocyte Nucleofector kit (Lonza, #VPD-1002) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... fibroblasts were transfected by nucleofection (Kit V4XP-2024, Lonza, Switzerland) with the gene drive plasmid ...
-
bioRxiv - Microbiology 2019Quote: ... and using the Amaxa human CD34+ cells Nucleofection Kit (Lonza), following the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2021Quote: ... from the P3 Primary Cell 96-well Nuclofector kit (Lonza). 3 µL of the assembled Cas9 RNPs were added to the cells ...
-
bioRxiv - Immunology 2022Quote: ... Cells were nucleofected using Cell Line Nucleofector Kit V (Lonza) for cell lines and P3 Primary Cell 4D-Nucleofector X Kit L (Lonza ...
-
bioRxiv - Bioengineering 2021Quote: ... tested for mycoplasma contamination using the MycoAlert Microplasma Kit (Lonza), and cultured with 0.2-micron filtered DMEM media (Thermo Fisher ...
-
bioRxiv - Developmental Biology 2019Quote: ... cells were kept in HCM medium (HCM Bullet Kit, Lonza) supplemented with “singlequots” supplied with the kit (except for the EGF ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... using the MycoAlert PLUS assay kit from Lonza (Basel, Switzerland), and were authenticated by short tandem repeat profiling.
-
bioRxiv - Neuroscience 2021Quote: ... 4D-Nucleofector™ unit X Kit (program CA-137; Lonza) was used according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... Cultures were tested for mycoplasma using a MycoAlert Kit (Lonza), and for bacteria ...
-
bioRxiv - Cell Biology 2023Quote: ... Nucleofection was performed using the Amaxa MEF2 Nucleofector Kit (Lonza) following the manufacturer’s suggested protocol ...
-
Chromatin priming elements direct tissue-specific gene activity prior to hematopoietic specificationbioRxiv - Genomics 2023Quote: ... with the P3 Primary Cell X kit (Lonza, V4XP-3024). ES cells clones were picked and screened for successful homologus CRISPR by PCR using primers designed outside of the CRISPR guide region (AAGGCTGTCTAGCACTCGTT ...
-
bioRxiv - Neuroscience 2023Quote: ... using the P3 Primary Cell nucleofector kit (Lonza, V4XP-3012). 8×105 cells were resuspended in 100µl P3 solution ...
-
bioRxiv - Systems Biology 2023Quote: ... and Mouse Embryonic Stem Cell NucleofectorTM Kit (#VPH-1001, Lonza). Three biological replicates were performed per library on different days ...
-
bioRxiv - Biochemistry 2023Quote: ... Using Amaxa SF Cell Line 4D-Nucleofector X Kit (Lonza), WT HEK293T cells were transfected with a transposase-encoding plasmid (pSB100X) ...
-
bioRxiv - Bioengineering 2023Quote: ... SE and P3 Cell Line 4D-Nucleofector X Kit (Lonza) was used as the nucleofection agent following the manufacturer’s protocol ...
-
Cancer-associated fibroblasts produce matrix-bound vesicles that influence endothelial cell functionbioRxiv - Cancer Biology 2023Quote: Transient knockdown was performed using the Amaxa kit R (Lonza) and Nucleofector device (program T-20 ...
-
bioRxiv - Cell Biology 2023Quote: Nucleofection was performed using the Amaxa MEF2 Nucleofector Kit (Lonza) following the manufecturer’s suggested protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... and gentamicin/amphotericin (Single Quots® kit, CC‒4127, Lonza), pH 7.40 ...
-
bioRxiv - Immunology 2023Quote: ... using a mouse T cell nucleofection kit (Lonza, VPA-1006), and rested overnight in R10 medium ...
-
bioRxiv - Molecular Biology 2023Quote: ... With the mouse ES Cell Nucleofector Kit (Lonza VPH-1001), PiggyBAC and pBASE plasmid are co-transfected into mESCs ...
-
bioRxiv - Cancer Biology 2023Quote: ... UWB1.289PT in the 50% RPMI-1640 (Gibco™)/ 50% MEGM (MEGM Bullet Kit; CC-3150, Lonza, Basel, Switzerland) supplemented with 3% FBS ...
-
bioRxiv - Bioengineering 2023Quote: ... and Amaxa Human CD34+ Cell Nucleofector kit (Lonza, Basel, Switzerland) according to manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... were nucleofected using P3 Primary cell 4D-nucleofection kit (Lonza) and DN100 pulse on 4D nucleofector X unit (Lonza) ...
-
bioRxiv - Cell Biology 2024Quote: ... in combination with the P3 Primary Cell Buffer Kit (Lonza). Per sample ...
-
bioRxiv - Genetics 2024Quote: ... and SF Cell Line 4D X Kit (Lonza, #V4XC-2024) were employed ...
-
bioRxiv - Cell Biology 2024Quote: ... and the Cell line Nucleofector Kit T (Lonza, VCA-1002) were used for the plasmids cells transfections (1-5 µg) ...
-
bioRxiv - Immunology 2023Quote: ... The levels of endotoxin in the purified protein samples were assessed using the QCL-1000 Limulus amebocyte lysate system (Lonza, Basel, Switzerland), and it was found that the recombinant proteins had endotoxin levels of ∼ 4 pg/µg ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The product was purified and 2 µg were added to the RNP and diluted in 100 µL P3 nucleofection buffer (Lonza). This mixture was nucleofected with 2×106 stimulated human primary T cells using the 4D-Nucleofector (Lonza ...
-
bioRxiv - Developmental Biology 2020Quote: ... The red blood cell lysis was performed by resuspending the pellet in 2 ml sterile ACK (Ammonium-Chloride-Potassium) lysis buffer (ACK Lysing Buffer, Lonza) and incubating on ice for 5 minutes ...
-
bioRxiv - Cancer Biology 2019Quote: ... Human cerebral microvascular endothelial cells (hCMEC/D3 [hCMEC]; gift from Dr. B. Weksler, Cornell Medical College) were grown in endothelial basal medium-2 (Lonza) supplemented with 5% FBS ...
-
bioRxiv - Cell Biology 2019Quote: ... were isolated from neonatal foreskin and cultured on 0.1% gelatin-coated culture dishes in 0.1% gelatin-coated culture dishes in EGM-2 MV media (Lonza #cc-3202). Both HUVEC and MEC were used before passage five in all experiments and the endothelial identity of the cells was confirmed by immunofluorescence microscopy with antibodies to endothelial markers PECAM-1 and VE-cadherin.
-
bioRxiv - Genomics 2021Quote: ... two million H9 hESCs were co-electroporated with the appropriate knockin vector (5 μg) and plasmids encoding AAVS1-targeting TALENs (2 μg; addgene, 59025 and 59026) using an Amaxa 4D Nucleofector system (Lonza). Serial cell dilutions were then seeded in six-well plates in E8 supplemented with Y-27632 (10 μM) ...
-
bioRxiv - Bioengineering 2021Quote: ... The hCMEC/D3 cells were cultured in complete media composed of endothelial cell basal medium-2 (Lonza Walkersville Inc., MD), supplemented with 5% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2020Quote: ... were resuspended at a density of 6×106 cells mL−1 in Microvascular Endothelial Cell Growth Medium-2 media (EGM-2MV, Lonza). The bottom channel of the chip was washed with EGM-2MV and loaded with 6 μL of HIMEC cell suspension (~36,000 cells per chip) ...
-
bioRxiv - Cell Biology 2020Quote: ... aliquots of obtained BM aspirates were seeded into cell culture flasks containing endothelial basal media (EBM-2, Lonza, Cologne, Germany) supplemented with 10% human platelet lysate (PL ...
-
bioRxiv - Bioengineering 2022Quote: ... Human hepatic stellate cell LX-2 was cultured in HEPES-buffered Dulbecco’s modified Eagle medium (DMEM) (Lonza BioWhittaker, Verviers, Belgium) supplemented with 4 mmol/L L-glutamine (Lonza) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and E15.5 (n=2–6) Six2-TROMA-1 stained kidneys were embedded in 1 % low melting agar (50100; Lonza Group). The lateral cortex of the kidneys was imaged with a Nikon A1R MP+ multiphoton microscope (Tokyo ...
-
bioRxiv - Microbiology 2020Quote: ... for Vero-118 cells and serum reduced (2%) DMEM supplemented with 100 IU/ml penicillin-100 μg/ml streptomycin mixture (Lonza), 2 mM L-glutamine (Lonza) ...
-
bioRxiv - Microbiology 2020Quote: ... and 3-fold (SARS-CoV-2 and SARS-CoV) serial dilutions of sample in serum-free EMEM supplemented with 20 µg/ml trypsin (Lonza) for MDCK cells ...
-
bioRxiv - Immunology 2021Quote: ... Cells were plated at 2 x 106 cells and cultured in RPMI with 10% FCS with low endotoxin levels (Lonza). After 14 d ...
-
bioRxiv - Cancer Biology 2022Quote: A small fragment (2-4 mm3) of tumor biopsies or surgically resected tumor was cultured in RPMI 1640 plus (Lonza) containing 10% FBS Hyclone (GE Healthcare) ...
-
bioRxiv - Microbiology 2022Quote: ... for 24 h then interleukin-2 (50U/ml) for 4-6 days before nucleofection (as recommended by the manufacturer, Lonza) or infection by HIV-1.
-
bioRxiv - Microbiology 2019Quote: ... All experiments were done with cells at passage 2 to 5 and cells were regularly checked for mycoplasma contamination (MicoAlert Lonza).