Labshake search
Citations for Lonza :
1601 - 1650 of 1926 citations for Rat Golgi phosphoprotein 3 GOLPH3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... the presence of mycoplasma in the cultures was regularly screened using the MycoAlert™ Mycoplasma Detection Kit (#LT07-218, Lonza).
-
bioRxiv - Cell Biology 2024Quote: ... The cell lines used in this study were routinely tested for mycoplasma contamination using MycoAlert Mycoplasma Detection Kit (#LT07-318, Lonza), and mycoplasma-negative cells were used ...
-
bioRxiv - Immunology 2024Quote: ... 5x1e6 cells were transfected with 5μg/plasmid DNA/million cells using a LONZA electroporator (program X-001) and LONZA electroporation kit for primary mouse T cells (VPA-1006; LONZA) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... All cell lines were routinely tested for Mycoplasma using a MycoAlert™ PLUS Mycoplasma Detection Kit (Cat# LT07-703, Lonza).
-
bioRxiv - Cancer Biology 2024Quote: ... Cell lines were maintained at 37 °C in a humidified atmosphere containing 5% carbon dioxide (CO2) and were tested for mycoplasma contamination using MycoAlert Mycoplasma detection kit (Lonza).
-
bioRxiv - Molecular Biology 2024Quote: All cells were cultured at 37°C in 5% CO2 in humidified incubators and were free from mycoplasma (MycoAlert Detection Kit, Lonza). Human primary hepatic stellate cells used for the main experiments were from Lonza (HUCLS ...
-
bioRxiv - Immunology 2024Quote: 3×106 of 3-day activated CD8+ T cells were transfected using the Human T Cell Nucleofector Kit (Amaxa Biosystem) and the Amaxa Nucleofector II system (Lonza), Program T-023 with 1.5/106 ...
-
bioRxiv - Biophysics 2024Quote: ... 0.5 μg of F-tractin-mScarlet plasmid and 0.75 ug of Zyxin-mNeonGreen plasmid were mixed with solution SE from SE Cell Line 4D-Nucleofector S Kits (Lonza). 4×105 cells were mixed with the plasmid-SE solution and nucleofected with program CM-137 using a 4D-Nucleofector (Lonza).
-
bioRxiv - Cell Biology 2024Quote: ... All cell lines were authenticated by Multiplex Cell Line Authentication (MCA) and were tested for mycoplasma by MycoAlert Mycoplasma Detection Kit (Lonza). HEK293T cells were transfected with the plasmids using 1mg/ml polyethylenimine ...
-
bioRxiv - Cancer Biology 2024Quote: ... All cell lines have been regularly monitored and tested negative for mycoplasma using a mycoplasma detection kit (Lonza, LT07-218).
-
bioRxiv - Cell Biology 2024Quote: ... nucleofected in a 100 µl reaction using the Lonza 4D-Nucleofector System with P3 Primary Cell 4D-Nucleofector X Kit (Lonza) and program CA137 ...
-
bioRxiv - Cancer Biology 2024Quote: ... All cell lines were routinely screened throughout the study and found to be negative for mycoplasma with the MycoAlert detection kit (Lonza).
-
bioRxiv - Cell Biology 2024Quote: ... 5 µg of pHTN HaloTag-CENP-A plasmid was used for transfection performed on Nucleofector Kit R with the Nucleofector 2b Device (Lonza) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... All primary cells were used at passages below 10 and were regularly tested for mycoplasma using the MycoAlert Mycoplasma Detection kit (Lonza). For the onset of transgenic expression cells were treated with 200 ng/mL DOX for 48 hours before being subjected to downstream assays unless otherwise specified.
-
bioRxiv - Cancer Biology 2024Quote: ... All cells were cultured at 37 °C in 5% CO2 and tested negative for mycoplasma contamination by MycoAlert mycoplasma detection kit (Lonza). Expression of doxycycline-inducible shRNA was induced by supplementing media with 0.1-1 µg/ml doxycycline for 6 days ...
-
bioRxiv - Immunology 2024Quote: ... and the GFPSpark and mCherry control vectors (DNA/cell ratio = 1.5 µg/106 cells in single transfections and 1.2 µg/106 cells in co-transfections) by using the Human T Cell Nucleofector Kit (Amaxa Biosystem) and the Amaxa Nucleofector II system (Lonza), Program T-023 ...
-
bioRxiv - Immunology 2024Quote: For RNAi-mediated TSP-1 and TSP-4 silencing 4×106 3-day activated CD8+ T cells were transfected using the Human T Cell Nucleofector Kit (Amaxa Biosystem) and the Amaxa Nucleofector II system (Lonza), Program T-023 with 150 pmol/106 cells of human TSP-1 and TSP-4-specific siRNAs (#s14108 and #s14100 ...
-
bioRxiv - Immunology 2024Quote: ... 8×106 CTLs were transfected with 6 µg of plasmid DNA of each construct with P3 Primary Cell 4D-Nucleofector X Kit (Lonza). For the CLEM experiments the cells were transfected with TSP-1-GFPSpark and TSP-4-mCherry ...
-
bioRxiv - Neuroscience 2024Quote: ... All fibroblasts and iPSCs were screened for mycoplasma monthly via MycoAlert™ PLUS Mycoplasma Detection Kit (Lonza Cat # 75860-362). iPSCs were grown in medium-sized colonies on Matrigel (BD Biosciences cat# ...
-
bioRxiv - Molecular Biology 2024Quote: ... and pCMV-Pbase (0.2µg) (kindly provided by L. Tiberi) using P1 Primary Cell 4D-NucleofectorTM X Kit L (Lonza; V4XP-1024) Amaxa Nucleofector (program FF104 ...
-
Antibodies targeting Crimean-Congo hemorrhagic fever virus GP38 limit vascular leak and viral spreadbioRxiv - Microbiology 2024Quote: ... All endothelial cells were cultured in endothelial cell growth basal medium 2 supplemented with an Endothelial Cell Growth Medium-2 (EGM-2) microvascular cells supplemental bullet kit (Lonza) and maintained at 37 °C with 5% CO2.
-
bioRxiv - Neuroscience 2024Quote: ... along with 20 μg recombinant Cas9 (IDT) and 1 pmol of each bridging oligonucleotide using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) using the CA-137 program34 ...
-
bioRxiv - Neuroscience 2024Quote: ... 500 pmol Cas12 crRNA (GGAAAAGTAAAAGATGTCTGAAT, IDT) and 20 μg recombinant Cas12 (IDT) using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) and 4D-Nucleofector X unit (Lonza ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2×105 cells were electroporated with 250 ng of gRNA plasmids and 750 ng of CBE using the SF Cell Line Nucleofector X Kit (Lonza) via the 4D-Nucleofector system ...
-
bioRxiv - Molecular Biology 2024Quote: ... Schizonts were transfected by electroporation using the Lonza 4D Nucleofector System according to the pulse program FI-115 with the P3 Primary Cell 4D-Nucleofector X Kit S (Lonza). After transfection ...
-
bioRxiv - Immunology 2024Quote: Nucleofection of Jurkat cells was performed using SE Cell Line 4D-Nucleofector™ X Kit L (Lonza, cat. V4XC-1012), while the P3 Primary Cell 4D-Nucleofector™ X Kit L (Lonza ...
-
bioRxiv - Microbiology 2024Quote: ... Full mature schizonts were purified from highly synchronized parasites and then transfected with pFCEN-rif plasmids with a Amaxa nucleofector 2 with parasite nucleofector kit 2 (LONZA). Since the pFCEN-rif has the human dihydrofolate reductase as a drug selectable marker ...
-
bioRxiv - Cancer Biology 2021Quote: ... Mycoplasma detection was routinely performed to ensure cells were not infected with mycoplasma by using MycoAlert Detection kit (Lonza, LT07-218). Cells were maintained at 37°C in a 5% CO2 incubator ...
-
bioRxiv - Cancer Biology 2021Quote: ... and transferred to the well of a 16-well Nucleocuvette™ strip (SF Cell Line 4D-NucleofectorTM X Kit S, Lonza). Cells were electroporated on a 4D-NucleofectorTM X Unit (Lonza ...
-
bioRxiv - Cell Biology 2019Quote: ... Feng and Coulombe 2015b) were transfected into Krt14-/- skin keratinocytes using P1 Primary Cell 4D-Nucleofector™ X Kit (V4XP-1024, Lonza). After nucleofection ...
-
bioRxiv - Cell Biology 2019Quote: ... was transfected into skin keratinocytes in primary culture using the P1 Primary Cell 4D-Nucleofector™ X Kit (V4XP-1024, Lonza).
-
bioRxiv - Cell Biology 2020Quote: Microspheres were tested for LPS contamination using the Limulus Amebocyte Lysate (LAL) QCL-1000™ kit (Lonza Walkersville, Inc., Olten, Switzerland) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... The cells were tested for mycoplasma on receipt of the cell line and quarterly thereafter using the MycoAlert Mycoplasma Detection Kit according to the manufacturer’s instructions (Lonza, Basel, Switzerland).
-
bioRxiv - Immunology 2021Quote: ... All generated THP1 and iMAC clones were tested negative for mycoplasma contamination using MycoAlert Mycoplasma Detection Kit (Lonza, Cat#LT07-318). THP1 cells were obtained from ATCC ...
-
bioRxiv - Developmental Biology 2020Quote: ... and nucleofected with BioID constructs using an Amaxa Nucleofector II and the Mouse Neural Stem Cell Nucleofector Kit (Lonza; VPG-1004) according the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: CRISPR plasmid constructs (2 μg) were electroporated into 2 × 106 Raji cells using the Amaxa Cell Line Nucleofector Kit V (Lonza Bioscience) (Program M-013) ...
-
bioRxiv - Neuroscience 2021Quote: ... Neuronal nucleofections were performed immediately before plating at 0 DIV by using an Amaxa Nucleofection Kit (Lonza, Basel, Switzerland, VPG-1003) according to the manufacturer’s optimized protocol (Number 101 ...
-
bioRxiv - Molecular Biology 2020Quote: ... by nucleofection using the Basic Nucleofector Kit for Primary Mammalian Fibroblasts with programme A-24 according to the manufacturer’s instructions (Lonza, Cologne, Germany). Cell clones were isolated after approximately 12 days of puromycin selection (1.5 µg/mL) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and ECs from healthy donor and patients were cultured in EGM-2 (EBM-2 + SingleQuots™ Kit) and 2% Foetal Bovine Serum (FBS) (Lonza). HUVECs and ECs were used between P2 and P6 passage ...
-
bioRxiv - Cell Biology 2020Quote: BMDMs (1 × 106 cells) were transfected with siRNA (250 pmol) and Amaxa Mouse Macrophage Nucleofector Kit (Lonza, catalog number VPA-1009) using a Lonza Nucleofector 2b device (Lonza ...
-
bioRxiv - Biophysics 2019Quote: ... Our working stock tested negative for mycoplasma contamination using the MycoAlert® Mycoplasma Detection Kit (Lonza Bioscience; Burton on Trent, UK). For experiments ...
-
bioRxiv - Microbiology 2021Quote: ... pcDNA3-JUP or empty vector were transfected into Caco-2 cells using SE Cell Line 4D-Nucleofector™ X Kit (Lonza) and an Amaxa 4D Nucleofector device from Lonza ...
-
bioRxiv - Genomics 2021Quote: ... Cell lines were authenticated by STR profiling and mycoplasma testing was performed using the MycoAlert™ PLUS Mycoplasma Detection Kit (Lonza). U2OS cells were grown in DMEM supplemented with 10% tetracycline-free foetal bovine serum (Clontech) ...
-
bioRxiv - Neuroscience 2020Quote: ... All cells were routinely tested for mycoplasma contamination with MycoAlert Mycoplasma Detection Kit (Lonza, Rockland, ME, USA, Cat N° LT07-318). Chemicals and cell culture reagents were purchased from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Cancer Biology 2020Quote: ... while MCF-10A cells were cultured as per ATCC recommendations in MEGM bullet kit growth media (CC-3150; Lonza, Walkersville, MD) without gentamycin-amphotericin B mix but with additional 100ng/ml cholera toxin (C8052 ...
-
bioRxiv - Cell Biology 2021Quote: Cell lines were cultured according to standard aseptic mammalian tissue culture protocols in 5% CO2 at 37 °C with regular testing for mycoplasma contamination using the MycoAlert™ Mycoplasma Detection Kit (Lonza). HCT 116 ...
-
Rag GTPases and Phosphatidylinositol 3-Phosphate Mediate Recruitment of the AP-5/SPG11/SPG15 ComplexbioRxiv - Cell Biology 2020Quote: ... The cell lines were routinely tested for the presence of mycoplasma contamination using MycoAlert™ Mycoplasma Detection Kit (LT07-318, Lonza), and were also regularly treated with mycoplasma removing agent (093050044 ...
-
bioRxiv - Cancer Biology 2021Quote: ... in a total volume of 100μL/ reaction and electroporated using an Amaxa TM Basic Nucleofector TM Kit for Primary Mammalian Epithelial cells (Lonza, # VPI-1005) and the NucleofectorTM 2b Device (Lonza ...
-
bioRxiv - Immunology 2022Quote: ... cells were resuspended with 10µL of primary cell nucleofection solution (P3 primary Cell 4D-Nucleofector X kit S (Lonza, # V4XP-3032), and mixed with RNP complexes ...
-
bioRxiv - Developmental Biology 2022Quote: ... and all cell lines are routinely monitored for mycoplasma infection monthly using the MycoAlert Mycoplasma Detection Kit (Lonza, Cat#LT08-118). Stem cells were maintained as previously described (Spence et al. ...