Labshake search
Citations for Lonza :
1601 - 1650 of 1759 citations for Propane 1 2 Diyl Diacetate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... The remaining tissue was minced and digested with stirring for 60 min in complete RPMI (RPMI1640; Lonza; supplemented with 10% fetal calf serum (FCS, 1% Pen/Strep; Lonza) containing 0.25 mg/ml Liberase TL (Roche ...
-
bioRxiv - Microbiology 2021Quote: ... The cells were washed once in PBS and then resuspended in 1 ml of ACK Red Blood Cell lysis buffer (Lonza). After washing with PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... Patients-derived iPS cells were electroporated with plasmids and single stranded DNA donor oligos using Human Stem Cell NucleofectorTM Kit 1 (Lonza). After 36 hours ...
-
bioRxiv - Plant Biology 2021Quote: ... the pollinated style was excised with a razor 5 mm above the ovary and placed horizontally on the aforementioned pollen germination medium solidified with 1% (w/v) NuSieve GTG Agarose (Lonza), followed by incubation at 25–30°C for 20 h under humid ...
-
bioRxiv - Microbiology 2020Quote: ... Homogenate was resuspended with 6 ml per brain of prewarmed complete media (DMEM [Corning]; 10% FBS; 1% Nonessential Amino Acids Mixture 100x, [Biowhittaker Reagents Lonza],1% GlutaMAX supplement 100x [Thermo Fisher Scientific] ...
-
bioRxiv - Microbiology 2021Quote: ... duncani parasites were maintained in A+ hRBCs (American Red Cross) at 5% hematocrit in HL-1 base medium (Lonza 344017) supplemented with 20% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2021Quote: 2×106 Elijah cells were washed in PBS and resuspended in 20 μl P3 Primary Cell Nucleofector Solution buffer prepared with Supplement 1 buffer (Lonza) according to the manufacturer’s instructions (P3 Primary Cell 4D-Nucleofector X Kit S) ...
-
bioRxiv - Systems Biology 2020Quote: ... 24 hours activated DC and T cells were incubated in 96 well plates at a DC/T ratio 1:5 in Xvivo15 medium (Lonza). After 6 days ...
-
bioRxiv - Microbiology 2020Quote: ... The same number of cells (2 x 106 cells) were lysed in 100 µl of 1% CHAPS/PBS and analyzed on 4-20% SDS-PAGE gel (Lonza). The envelope proteins were detected by 2F5 (specific for gp41 ...
-
bioRxiv - Immunology 2021Quote: ... MICB or ULBP-1 genes after optimizing nucleofection conditions using primary cell 4D nucleofector kit and 4D nucleofector system (Lonza). After 48 hours of culture ...
-
bioRxiv - Neuroscience 2022Quote: ... and ssODN (1 μl,stock 100 μM) in 20 μl of nucleofection buffer P3 were nucleofected (program CA137, 4D-Nucleofector Device, Lonza) into 500,000 detached iPSCs (Deneault et al. ...
-
bioRxiv - Microbiology 2022Quote: ... Ribonucleoproteins were introduced into 1 × 106 sub-confluent BlaER1 cells using 4D-Nucleofector X Unit and SF Cell line Kit (Lonza), applying program DN-100 ...
-
bioRxiv - Immunology 2022Quote: ... COPD or smoker human donors (Table 1) were grown using Bronchial Epithelial Growth Media (CC-3170) and harvested using ReagentPack Subculture reagents (CC-5034) (Lonza). BEAS-2B bronchial epithelial cells were obtained from the American Type Culture Collection (ATCC CRL-9609 ...
-
bioRxiv - Microbiology 2022Quote: ... 10 μg of the pSAG1::Cas9-U6::sgUPRT vector15 and 10 μg of the barcode oligo (equivalent to an ~1:160 molar ratio of plasmid to oligo) were co-transfected into approximately 1×106 extracellular tachyzoites using the 4D-Nucleofector X Unit programme F1-115 (Lonza). 24 hours post-transfection ...
-
bioRxiv - Cancer Biology 2022Quote: ... and TILs were resuspended at a cell density of 1 million cells in 20 µL P3 electroporation buffer with supplement (Lonza) and then combined with 3 µL of RNP mixture and nucleofected using program DJ-110 (melanoma ...
-
bioRxiv - Immunology 2020Quote: ... Rinsed cells were resuspended in buffer P4 (mouse) or P2 (human) at 1-10 x 106 cells/20 μL (Lonza). Non-targeting Alt-R crRNA #1 ...
-
bioRxiv - Neuroscience 2021Quote: ... dissociated with Accutase and then transfected with one of the Tau or Tubulin pUCM vectors along with AAVS1 TALEN pairs using a Human Stem Cell Nucleofector Kit 1 (Lonza) with the Nucleofector 2b Device (Lonza) ...
-
bioRxiv - Immunology 2021Quote: CD4+ T cells were activated with plate-bound α-CD3 (3.75 µg/ml; Immunotech) and soluble α-CD28 (1 μg/mL; Immunotech) in X-vivo 20 serum-free medium (Lonza). X-vivo 20 medium was supplemented with L-glutamine (2 mM ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were washed once in PBS and then resuspended in 1 ml of ACK Red Blood Cell lysis buffer (Lonza). After washing with PBS ...
-
bioRxiv - Bioengineering 2020Quote: ... 8 volumes of collagen I gel solution (10mg/ml) were mixed with 1 volume of 10X EMEM (Lonza: 12-684F) and 1 volume of 10X Reconstruction buffer(Anacker and Moody 2012 ...
-
bioRxiv - Immunology 2022Quote: ... 1*106 purified naïve T-cells were resuspended in 15 μL buffer P3 + 5 μL Supplement 1 (P3 Primary Cell 4D-NucleofectorTM X Kit S; Lonza) and mixed with 2.7 μL RNP in the 16-well strips provided in the kit ...
-
bioRxiv - Developmental Biology 2020Quote: ... The guide RNA vector was then electroporated into the parent line containing the CRISPRi system using the Human Stem Cell Nucleofector Kit 1 solution with the Amaxa nucleofector 2b device (Lonza). Nucleofected cells were then seeded into a 6-well plate in mTeSR™-1 supplemented with Y-27632 (10 μM ...
-
bioRxiv - Immunology 2020Quote: 2×106 freshly isolated primary B cells were washed in PBS and resuspended in 20 μl P3 Primary Cell Nucleofector Solution buffer prepared with Supplement 1 buffer (Lonza) according to the manufacturer’s instructions (P3 Primary Cell 4D-Nucleofector X Kit S) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lung cancer cell lines (H3122, H2228, A549, H460, Calu-1, and H1437) were cultured in RPMI-1640 (Lonza, 15-1675) supplemented with 10% FBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... two pieces of polyethylene tubing (Portex) were connected to two 1 mL gas-tight syringes (SGE) and filled with sterile PBS (Lonza) buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... The lysis mix and bead suspensions were loaded in the tubing of two individual 1 ml SGE glass syringes filled with PBS (Lonza), and separated by an air bubble from the reagents in the tubing as previously described ...
-
bioRxiv - Molecular Biology 2021Quote: 3T3-L1 fibroblasts were maintained in DMEM supplemented with 10% newborn calf serum (NCS) and 1% penicillin/streptomycin (P/S) (all Lonza). Experiments were performed in six-well plates ...
-
bioRxiv - Cell Biology 2020Quote: ... The purity of CyaA batches is higher than 90% as judged by SDS PAGE analysis and contained less than 1 EU of LPS/μg of protein as determined by a standard LAL assay (Lonza). Finally ...
-
bioRxiv - Immunology 2021Quote: ... Naïve T cells expressing Cas9 were washed once with 1 mL pre-warmed recovery medium (Mouse T Cell Nucleofector Medium, Lonza) before electroporation ...
-
bioRxiv - Immunology 2021Quote: ... CD4+ T-cells were stimulated with plate-bound α-CD3 (3.75 μg/ml; Immunotech) and soluble α-CD28 (1 μg/mL; Immunotech) in X-vivo 20 serum-free medium (Lonza). X-vivo 20 medium was supplemented with L-glutamine (2 mM ...
-
bioRxiv - Immunology 2021Quote: ... The enriched CD4+CD25hi cells were cultured in 24-well non-tissue culture plates at 1 x 106 cells/mL in X-Vivo-15 (Lonza) supplemented with 10% heat-inactivated human AB serum (Sigma) ...
-
bioRxiv - Immunology 2021Quote: ... 1 × 106 NALM6 target cells were transfected with 1 μg plasmid using the Nucleofector 4D (SF cell line Kit, program CV-104, Lonza) following the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2021Quote: African green monkey kidney epithelial BSC-1 cells (ATCC CCL-26) were maintained in Eagle’s minimal essential medium (EMEM; Lonza, Inc.) containing 5% fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2023Quote: ... Knock-down procedures were performed with siRNA purchased from Riboxx (non-targeting siRNA: UUGUACUACACAAAAGUACCCCC; US10 targeting #1: UUCUGAAUAACACAGCCGCCCCC) applying the SE Cell Line Kit (Lonza) for fibroblasts and Lipofectamine RNAiMax (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: Larvae were anesthetized with 0.02% ethyl 3-aminobenzoate methanesulfonate salt (Tricane, (E10521, Ethyl 3-aminobenzoate methanesulfonate) and mounted in 1% low melting point agarose (50100, Lonza) in a 60 mm x 15 mm petri dish ...
-
bioRxiv - Cancer Biology 2023Quote: Cell and organoid lines were generated from C3-TAg tumors (supplementary file 1) and tested for mycoplasma (Lonza, LT07-703) prior to use and the creation of frozen stocks ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5-6 million primary human keratinocytes were electroporated with 1 nmol siPools using the Amaxa human keratinocyte Nucleofector kit (Lonza) according to the manufacturer’s instructions and the T-018 program of the Amaxa Nucleofector II device (Lonza) ...
-
bioRxiv - Physiology 2023Quote: ... 2 μl of KCNQ2/3 cDNA plasmid (0.9 g/l) and 1 μl of pmax green fluorescent protein vector (0.5 g/l) (Lonza, Cologne, Germany) were diluted in 125 μl of Opti-MEM medium (Life Technologies) ...
-
bioRxiv - Microbiology 2023Quote: ... Ribonucleoproteins were introduced into 1 x 106 sub-confluent BLaER1 cells using 4D-Nucleofector X Unit and SF Cell line Kit (Lonza), applying program DN-100 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Measured tissues originated from six F508del homozygous patients (CF patient #1: CF-AB0609, female, 31 years-old; CF patient# 3: #28388-0000450918, Lonza, male ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 100 μL of YEA medium containing 1% (w/v) microwave-heated low-melting point agarose (SeaPlaque agarose, 50101; Lonza) was gently added to the central area ...
-
bioRxiv - Cell Biology 2022Quote: ... Two million of MNCs were transfected with 10 μg of plasmid (5:1 ratio pEB-C5:pEBTg) as instructed by the Lonza CD34+ nucleofector kit (VPA-1003, Lonza) and Amaxa nucleofector (program T-016 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 × 106 wild-type K562 cells were electroporated in 100 μl of Amaxa solution (Lonza Nucleofector 2b, program T-016) with 1 µg of PiggyBac expression vector (PB200A-1 ...
-
bioRxiv - Bioengineering 2024Quote: ... Beads were mixed at a 1:1 ratio with cells and cells were cultured at a density of 1 x 106 cells/mL in complete X-Vivo 15 culture media (Lonza, 5% fetal bovine serum ...
-
bioRxiv - Cell Biology 2024Quote: ... together with a plasmid encoding the piggyBac transposase in a 3:1 ratio (vector:transposase) using the P3 Primary cell 4D-Nucleofector™ kit (Lonza). Prior to targeting ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 × 106 OSCs were transfected with 4 μg of pPB-TRE3G-FLAG-Rhino-Tjen-trTA-P2A-BlastR and 1 μg of pHsp70-Myc-hyPBase using Nucleofector Kit V (Lonza). After incubation in media containing blasticidin (50 μg/mL) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Supernatant was removed and cells were resuspended in P3 Primary Cell Nucleofector® Solution with Supplement 1 (Lonza, V4XP-3032) at 5-15 million cell/mL ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were passaged 1:10 every 3-4 days by trypsinisation and were regularly screened for mycoplasma contamination (Mycoalert, Lonza).
-
bioRxiv - Immunology 2024Quote: Ten micrograms of expression plasmid or 20 pmol of siRNA were introduced into 1 x 107 BMDC cells by electroporation using a Nucleofector 2b (Lonza) with an Amaxa Mouse Dendritic Cell Nucleofection Kit (Lonza) ...
-
bioRxiv - Immunology 2024Quote: ... The reaction contained 400 pmol of Cas9 protein and 1 × 107 of the transduced NK cells in 100 µL of P3 solution (Lonza). Immediately after electroporation ...